Informations

9.5C : Tropisme tissulaire dans les virus animaux - Biologie

9.5C : Tropisme tissulaire dans les virus animaux - Biologie


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Le tropisme de l'hôte fait référence à la manière dont les virus/agents pathogènes déterminent quelles cellules sont infectées par un agent pathogène donné.

Objectifs d'apprentissage

  • Expliquer le tropisme viral

Points clés

  • Les virus doivent se lier à des récepteurs spécifiques de la surface cellulaire pour entrer dans une cellule.
  • Si une cellule n'exprime pas ces récepteurs, le virus ne peut normalement pas l'infecter.
  • En virologie, le tropisme tissulaire désigne les cellules et les tissus d'un hôte qui soutiennent la croissance d'un virus ou d'une bactérie particulier. Certains virus ont un large tropisme tissulaire et peuvent infecter de nombreux types de cellules et de tissus. D'autres virus peuvent infecter principalement un seul tissu.

Mots clés

  • cellule dendritique: Toute cellule, ayant des processus de ramification, qui fait partie du système immunitaire des mammifères.
  • macrophage: Un globule blanc qui phagocyte les débris cellulaires nécrotiques et les corps étrangers, y compris les virus, les bactéries et l'encre de tatouage. Il présente des antigènes étrangers sur le CMH II aux lymphocytes. Une partie du système immunitaire inné.

Un tropisme est un phénomène biologique, indiquant la croissance ou le mouvement tournant d'un organisme biologique en réponse à un stimulus environnemental. Dans les tropismes, cette réponse dépend de la direction du stimulus (par opposition aux mouvements nastiques qui sont des réponses non directionnelles). Les virus et autres agents pathogènes affectent également ce que l'on appelle le « tropisme de l'hôte » ou le « tropisme cellulaire ». Le tropisme de cas fait référence à la manière dont différents virus/agents pathogènes ont évolué pour cibler préférentiellement des espèces hôtes spécifiques ou des types cellulaires spécifiques au sein de ces espèces.

Le tropisme de l'hôte est le nom donné à un processus de tropisme qui détermine quelles cellules peuvent être infectées par un agent pathogène donné. Le tropisme de l'hôte est déterminé par les complexes de récepteurs biochimiques sur les surfaces cellulaires qui sont permissifs ou non permissifs à l'amarrage ou à la fixation de divers virus.

Divers facteurs déterminent la capacité d'un agent pathogène à infecter une cellule particulière. Par exemple, les virus doivent se lier à des récepteurs de surface cellulaire spécifiques pour entrer dans une cellule. Si une cellule n'exprime pas ces récepteurs, le virus ne peut normalement pas l'infecter. Le tropisme viral est déterminé par une combinaison de susceptibilité et de permissivité : une cellule hôte doit être à la fois permissive (permettre l'entrée virale) et sensible (posséder le complément de récepteur nécessaire à l'entrée virale) pour qu'un virus puisse établir une infection. Un exemple en est le virus VIH, qui présente un tropisme pour les cellules immunitaires apparentées au CD4 (par exemple, les cellules T auxiliaires, les macrophages ou les cellules dendritiques). Ces cellules expriment un récepteur CD4, auquel le virus VIH peut se lier, via les protéines gp120 et gp41 à sa surface.

En virologie, le tropisme tissulaire désigne les cellules et les tissus d'un hôte qui soutiennent la croissance d'un virus ou d'une bactérie particulier. D'autres virus peuvent infecter principalement un seul tissu.

Les facteurs influençant le tropisme tissulaire viral comprennent : 1) la présence de récepteurs cellulaires permettant l'entrée virale, 2) la disponibilité de facteurs de transcription impliqués dans la réplication virale, 3) la nature moléculaire du tropogène viral, et 4) les récepteurs cellulaires sont les protéines présentes sur une surface cellulaire ou virale.

Ces récepteurs sont comme des clés permettant à la cellule virale de fusionner avec une cellule ou de s'attacher à une cellule. La façon dont ces protéines sont acquises se fait par un processus similaire à celui d'un cycle d'infection.


Système d'administration d'oxyde nitrique et procédés d'utilisation

Des modes de réalisation de la présente invention concernent des systèmes et des dispositifs pour administrer de l'oxyde nitreux gazeux (gNO) selon des paramètres thérapeutiques afin de réduire l'infection chez un sujet. Certains modes de réalisation comprennent des dispositifs et des systèmes d'administration de gNO sous pression pour réduire la charge microbienne et favoriser la cicatrisation des plaies de sujets atteints de diverses maladies, notamment les infections de la peau et des tissus mous (SSTI) et l'ostéomyélite. Dans certains modes de réalisation, la présente invention concerne des dispositifs portables de cicatrisation des plaies pour administrer du gNO sous pression au site d'une plaie afin de traiter divers états pathologiques chez un sujet.

La présente demande revendique le bénéfice de la demande de brevet provisoire américaine Ser. N° 62/079 461, déposé le 13 novembre 2014. Cette demande est incorporée ici à titre de référence dans son intégralité à toutes fins utiles.

DÉCLARATION CONCERNANT LA RECHERCHE FINANCÉE PAR LE FÉDÉRAL

Les modes de réalisation décrits ici ont été soutenus en partie par la Defense Advanced Research Projects Agency (DARPA), DARPA Grant No. HR 0011-11-1-0006. Le gouvernement a certains droits sur cette invention.

Des modes de réalisation de la présente invention concernent des systèmes et des dispositifs pour administrer de l'oxyde nitreux gazeux (gNO) selon des paramètres thérapeutiques afin de réduire une infection ciblée chez un sujet. Certains modes de réalisation comprennent des dispositifs et des systèmes pour délivrer du gNO sous pression pour réduire la charge biologique et favoriser la cicatrisation des plaies d'un sujet présentant un ou plusieurs problèmes de santé, y compris, mais sans s'y limiter, les infections de la peau et des tissus mous (SSTI) et/ou l'ostéomyélite. Certains modes de réalisation décrits ici concernent la réduction d'infections pathogènes dans les tissus mous d'un sujet afin de favoriser la cicatrisation des plaies persistantes ou chroniques.

L'oxyde nitrique (NO) est une petite molécule messager omniprésente impliquée dans de nombreux processus pathologiques et physiologiques. Le NO joue un rôle essentiel dans les voies de transduction du signal vasculaire et neuronal, la contractilité des muscles lisses, la bioénergétique, l'adhésion et l'agrégation plaquettaires, l'immunité et la régulation de la mort cellulaire. La carence en NO est impliquée dans de nombreux processus physiopathologiques tels que l'hypertension, les dysfonctionnements cardiovasculaires, la neurodégénérescence, l'arthrite, l'asthme et le choc septique. Le NO est l'une des rares molécules de signalisation gazeuses connues et est en outre exceptionnel du fait qu'il s'agit d'un gaz radicalaire. C'est un sous-produit connu dans presque tous les types d'organismes, allant des bactéries aux plantes, aux champignons et aux cellules animales.

Il existe plusieurs mécanismes par lesquels il a été démontré que le NO affecte la biologie des cellules vivantes. Ceux-ci comprennent l'oxydation de protéines contenant du fer telles que la ribonucléotide réductase et l'aconitase, l'activation de la guanylate cyclase soluble, la ribosylation ADP des protéines, la nitrosylation du groupe sulfhydryle de la protéine et l'activation du facteur de régulation du fer. Il a également été démontré que le NO active le NF-κB dans les cellules mononucléées du sang périphérique, un facteur de transcription important dans l'expression du gène iNOS en réponse à l'inflammation. De plus, lors d'une réponse immunitaire, le NO est sécrété sous forme de radicaux libres et est toxique pour de nombreuses bactéries et parasites intracellulaires.

L'administration de NO exogène ne constitue pas seulement un moyen puissant de compléter le NO lorsqu'un sujet ne peut pas en générer suffisamment pour les fonctions biologiques normales, elle offre également un moyen d'accélérer la cicatrisation des plaies et de réduire la biocharge chez un sujet. Le NO produit à la fois par iNOS et eNOS joue de nombreux rôles importants dans la cicatrisation des plaies, de la phase inflammatoire jusqu'au remodelage de la cicatrice. En particulier, le NO exerce des effets cytostatiques, chimiotactiques et vasodilatateurs au cours de la réparation précoce des plaies, régule la prolifération et la différenciation de plusieurs types cellulaires, module le dépôt de collagène et l'angiogenèse et affecte la contraction des plaies. Cependant, le moment, la concentration, la pressurisation et le site d'administration du NO sont tous des facteurs critiques mal compris affectant la capacité du NO à faciliter la réparation des plaies.

Des modes de réalisation de la présente invention concernent des systèmes et des dispositifs pour administrer de l'oxyde nitreux gazeux (gNO) selon des paramètres thérapeutiques afin de réduire une infection ciblée chez un sujet. Certains modes de réalisation comprennent des dispositifs et des systèmes pour délivrer du gNO sous pression pour réduire la charge biologique et favoriser la cicatrisation des plaies d'un sujet présentant un ou plusieurs problèmes de santé, y compris, mais sans s'y limiter, les infections de la peau et des tissus mous (SSTI) et/ou l'ostéomyélite. Certains modes de réalisation décrits ici concernent la réduction d'infections pathogènes dans les tissus mous d'un sujet afin de favoriser la cicatrisation des plaies persistantes ou chroniques.

Des modes de réalisation de la présente invention concernent un dispositif d'administration d'oxyde nitrique gazeux (gNO) pour administrer du gNO sous pression à un sujet. Dans certains modes de réalisation, le dispositif comprend une source de gNO fonctionnellement couplée à une unité d'interface sujet, un régulateur de débit de gaz qui mesure le débit du gNO et un régulateur de pression de gaz qui mesure la pression du gNO lorsque le gNO est délivré à travers l'interface sujet. unité au sujet, dans laquelle le gNO traite une infection chez le sujet.

Dans certains modes de réalisation, la pression du gNO délivré au sujet est d'environ 0,15 ATM à environ 1,0 ATM.

Dans d'autres modes de réalisation, le gNO est délivré au sujet à un débit d'environ 0,1 litre/minute à environ 1,0 litre/minute.

Dans certains modes de réalisation, la concentration du gNO délivré au sujet est d'environ 1,0 %.

Dans certains modes de réalisation, le gNO est délivré au sujet en continu pendant environ 30 minutes à environ 120 minutes.

Dans encore d'autres modes de réalisation, un dispositif peut en outre comprendre un ou plusieurs capteurs d'oxyde nitrique.

Dans certains modes de réalisation, le dispositif peut en outre comprendre un ou plusieurs capteurs d'oxygène.

Dans encore un autre mode de réalisation, un dispositif peut en outre comprendre un mécanisme de rinçage au gaz pour réduire l'incidence ou empêcher le sujet d'être exposé au gNO lorsque l'unité d'interface sujet est retirée.

Dans certains modes de réalisation, l'unité d'interface sujet comprend une sortie de gaz pour assurer un écoulement continu du gNO et une exposition continue du gNO au sujet.

Dans certains modes de réalisation, l'unité d'interface sujet comprend un mécanisme de fixation pour maintenir un joint sur le sujet (ou une zone de l'appendice d'un sujet) pendant que le gaz gNO est délivré.

Dans d'autres modes de réalisation, le traitement de l'infection chez le sujet comprend la réduction de la charge biologique dans une plaie située sur le sujet.

Dans certains modes de réalisation, le traitement de l'infection chez le sujet peut comprendre la réduction d'un ou plusieurs symptômes associés à l'infection.

Dans certains modes de réalisation, le traitement du sujet comprend la réduction du risque de développer une infection d'un ou plusieurs organismes pathogènes chez le sujet en les préexposant au gNO avant l'apparition d'une infection au niveau d'un site de plaie. Conformément à ces modes de réalisation, un sujet peut être traité avec du gNO lors de la présentation d'une nouvelle plaie.

Dans d'autres modes de réalisation, l'infection comprend une zone du corps du sujet infectée par au moins un agent pathogène choisi dans le groupe constitué d'une bactérie, d'un virus, d'un champignon, d'un parasite, d'un arthropode, d'un protozoaire et d'une bactérie résistante aux antibiotiques, ou une combinaison de ceux-ci.

Dans certains modes de réalisation, l'infection est une lésion, y compris, mais sans s'y limiter, une plaie chirurgicale, une plaie traumatique, une brûlure, un abcès, une kératose actinique, une chéloïde, une cicatrice et un cancer de la peau et une combinaison de ceux-ci.

Des modes de réalisation de la présente divulgation comprennent également un système d'administration d'oxyde nitrique gazeux (gNO) pour administrer du gNO sous pression à un sujet. Dans certains modes de réalisation, le système comprend une source de gNO fonctionnellement couplée à une unité d'interface sujet, un régulateur de débit de gaz qui mesure le débit du gNO et un régulateur de pression de gaz qui mesure la pression du gNO lorsque le gNO est délivré à travers l'interface sujet. unité au sujet, dans laquelle le gNO traite, prévient l'apparition ou réduit l'apparition d'une infection chez le sujet.

Dans certains modes de réalisation selon les systèmes décrits ici, la pression du gNO délivré au sujet est d'environ 0,15 ATM à environ 1,0 ATM, le débit du gNO délivré au sujet étant d'environ 0,1 litre/minute à environ 1,0 litre/ minute, et dans lequel la concentration du gNO délivré au sujet est d'environ 1,0 %.

Dans d'autres modes de réalisation, le système décrit ici comprend un ou plusieurs capteurs d'oxygène, d'oxyde nitrique ou de dioxyde nitrique.

Dans certains modes de réalisation, le traitement d'une infection chez le sujet à l'aide d'un système décrit ici comprend la réduction de la charge biologique (par exemple, des organismes pathogènes) dans une plaie sur le sujet.

Dans d'autres modes de réalisation, un système décrit ici peut comprendre en outre l'inclusion d'un mécanisme de rinçage au gaz pour empêcher le sujet d'être exposé au gNO lorsque l'unité d'interface sujet est retirée.

Dans certains modes de réalisation, l'unité d'interface sujet comprend une sortie de gaz pour assurer un écoulement continu du gNO et une exposition continue du gNO au sujet.

Des modes de réalisation de la présente divulgation comprennent également un procédé de traitement d'une plaie sur un sujet. Dans certains modes de réalisation, le procédé comprend la fixation d'une unité d'interface sujet à un site de blessure sur le sujet, l'unité d'interface sujet couplée fonctionnellement à une source d'oxyde nitrique gazeux (gNO), et la délivrance d'une quantité efficace de gNO au site de blessure sur le sujet, dans lequel le gNO traite le site de la plaie sur le sujet.

Dans certains modes de réalisation, la pression du gNO délivré au site de la plaie sur le sujet est d'environ 0,15 ATM à environ 1,0 ATM, le débit du gNO délivré au site de la plaie sur le sujet étant d'environ 0,1 litre/minute à environ 1,0 litre/minute, et dans lequel la concentration du gNO délivré au site de la plaie sur le sujet est d'environ 1,0 %.

Dans certains modes de réalisation, le gNO est délivré au site de la plaie sur le sujet en continu pendant environ 30 minutes à environ 120 minutes.

Dans d'autres modes de réalisation, le traitement du site de la plaie comprend la réduction de la charge biologique dans une infection du site de la plaie.

Dans certains modes de réalisation, le traitement du site de la plaie comprend la réduction du risque de développer une infection dans le site de la plaie.

Tels qu'utilisés ici, les termes « sujet », « utilisateur » et/ou « patient » peuvent inclure les humains et d'autres animaux ou mammifères qui ont besoin d'un traitement et qui sont capables d'utiliser ou d'avoir une utilisation assistée des dispositifs et systèmes décrits ici. De plus, les termes « sujet », « utilisateur » et/ou « patient » peuvent inclure des humains et d'autres mammifères traités dans tout type d'environnement tel qu'un environnement clinique, un cadre non clinique, un cadre expérimental, etc. Dans les modes de réalisation, un l'utilisateur peut être incapable d'exploiter efficacement les divers systèmes de distribution gNO et peut nécessiter l'assistance d'un tiers. Ainsi, les fonctions exécutées par « l'utilisateur » peuvent inclure des fonctions exécutées par un fournisseur tiers, tel qu'un fournisseur de soins de santé et/ou une autre personne autorisée associée à l'utilisateur.

Les termes « déterminer », « calculer » et « calculer » et leurs variations, tels qu'utilisés ici, sont utilisés de manière interchangeable et incluent tout type de méthodologie, de processus, d'opération mathématique ou de technique.

Il est à noter que le terme « une » ou « une » entité fait référence à une ou plusieurs de cette entité. En tant que tels, les termes « un » (ou « un »), « un ou plusieurs » et « au moins un » peuvent être utilisés de manière interchangeable ici. Il convient également de noter que les termes « comprenant », « incluant » et « ayant » peuvent être utilisés de manière interchangeable.

Tels qu'utilisés ici, « au moins un », « un ou plusieurs » et « et/ou » sont des expressions ouvertes qui sont à la fois conjonctives et disjonctives en fonctionnement. Par exemple, chacune des expressions « au moins un de A, B et C », « au moins un de A, B ou C », « un ou plusieurs de A, B et C », « un ou plusieurs de A, B ou C » et « A, B et/ou C » signifie A seul, B seul, C seul, A et B ensemble, A et C ensemble, B et C ensemble, ou A, B et C ensemble. Lorsque chacun de A, B et C dans les expressions ci-dessus fait référence à un élément, tel que X, Y et Z, ou à une classe d'éléments, telle que X1-Xn, Y1-Ym et Z1-Zo, la phrase est destiné à faire référence à un seul élément sélectionné parmi X, Y et Z, une combinaison d'éléments sélectionnés dans la même classe (par exemple, X1 et X2) ainsi qu'une combinaison d'éléments sélectionnés parmi deux ou plusieurs classes (par exemple, Y1 et Zo).

Le terme « moyens » tel qu'il est utilisé ici doit recevoir son interprétation la plus large possible conformément à 35 U.S.C. § 112(f). En conséquence, une revendication incorporant le terme « moyens » couvrira toutes les structures, matériaux ou actes énoncés dans les présentes, et tous leurs équivalents. En outre, les structures, matériaux ou actes et leurs équivalents doivent inclure tous ceux décrits dans le résumé, la brève description des dessins, la description détaillée, l'abrégé et les revendications elles-mêmes.

Il doit être compris que chaque limitation numérique maximale donnée tout au long de cette divulgation est réputée inclure chaque limitation numérique inférieure en tant qu'alternative, comme si ces limitations numériques inférieures étaient expressément écrites ici. Chaque limitation numérique minimale donnée tout au long de cette divulgation est réputée inclure chaque limitation numérique supérieure à titre d'alternative, comme si ces limitations numériques supérieures étaient expressément écrites ici. Chaque plage numérique donnée tout au long de cette divulgation est réputée inclure chaque plage numérique plus étroite qui tombe dans une telle plage numérique plus large, comme si ces plages numériques plus étroites étaient toutes expressément écrites ici.

Ce qui précède est un résumé simplifié de la divulgation pour fournir une compréhension de certains aspects de la divulgation. Ce résumé n'est ni un aperçu étendu ni exhaustif de la divulgation et de ses divers aspects, modes de réalisation et configurations. Il ne vise ni à identifier les éléments clés ou critiques de la divulgation ni à délimiter la portée de la divulgation, mais à présenter des concepts sélectionnés de la divulgation sous une forme simplifiée en guise d'introduction à la description plus détaillée présentée ci-dessous. Comme on le comprendra, d'autres aspects, modes de réalisation et configurations de la divulgation sont possibles en utilisant, seuls ou en combinaison, une ou plusieurs des caractéristiques énoncées ci-dessus ou décrites en détail ci-dessous.

DESCRIPTION BRÈVE DES DESSINS

Les dessins annexés sont incorporés et font partie de la description pour illustrer plusieurs exemples de la présente divulgation. Ces dessins, ainsi que la description, expliquent les principes de la divulgation. Les dessins illustrent simplement des exemples préférés et alternatifs de la manière dont la divulgation peut être réalisée et utilisée et ne doivent pas être interprétés comme limitant la divulgation aux seuls exemples illustrés et décrits. D'autres caractéristiques et avantages deviendront apparents à partir de la description suivante, plus détaillée, des divers aspects, modes de réalisation et configurations de la divulgation, comme illustré par les dessins référencés ci-dessous.

FIGUE. 1 est une représentation d'un dispositif portable de distribution d'oxyde nitrique gazeux (gNO), selon un mode de réalisation de la présente divulgation.

FIGUES. 2A-2C sont des représentations de trois unités d'interface sujet qui se couplent au dispositif de délivrance de NO, selon des modes de réalisation de la présente divulgation.

FIGUE.3 est un dessin représentatif d'un dispositif portable de délivrance de gNO qui ne nécessite pas de collecteur, selon un mode de réalisation de la présente divulgation.

FIGUE. 4 est un graphique illustrant les effets du traitement par gNO sur la charge biologique après trois heures d'infection bactérienne, selon un mode de réalisation de la présente divulgation.

FIGUES. 5A-5C sont des coupes histologiques représentatives colorées pour détecter la présence de bactéries sur des tissus traités et non traités, selon des modes de réalisation de la présente divulgation. ( FIG. 5A : tissu blessé non infecté FIG. 5B : tissu blessé et infecté pendant 3 heures et FIG. 5C : tissu blessé et infecté pendant 24 heures)

FIGUES. 6A-6F sont des coupes histologiques représentatives colorées pour détecter les composants du biofilm bactérien, selon un mode de réalisation de la présente divulgation. (La figure 6A est colorée avec de l'hématoxyline et de l'éosine. La figure 6B est colorée avec la réaction de Feulgen. La figure 6C est colorée avec du rouge Congo modifié. La figure 6D est colorée avec du rouge Congo modifié avec de la carbol fuchsine. La figure 6E est colorée avec du PAS La figure 6F est teinté au Calcofluor)

Tandis que la description se prête à diverses modifications et formes alternatives, des modes de réalisation spécifiques ont été illustrés à titre d'exemple dans les dessins et sont décrits en détail ci-dessous. L'intention, cependant, n'est pas de limiter la divulgation aux modes de réalisation particuliers décrits. Au contraire, la divulgation est destinée à couvrir toutes les modifications, équivalents et alternatives entrant dans le cadre de la divulgation et/ou des revendications.

DESCRIPTION DÉTAILLÉE

Des modes de réalisation de la présente invention concernent des systèmes et des dispositifs pour administrer de l'oxyde nitreux gazeux (gNO) selon des paramètres thérapeutiques afin de réduire l'infection chez un sujet. Certains modes de réalisation comprennent des dispositifs et des systèmes d'administration de gNO sous pression pour réduire la charge microbienne et favoriser la cicatrisation des plaies de sujets atteints de diverses maladies, notamment les infections de la peau et des tissus mous (SSTI) et l'ostéomyélite.

FIGUE. 1 est une représentation d'un dispositif portable de distribution de gNO, selon un mode de réalisation de la présente divulgation. Le dispositif de distribution de NO portable de la présente invention peut comprendre un collecteur 100 qui comprend un régulateur de pression de gaz 105, un régulateur de débit de gaz 110, et une unité d'interface sujet. Les dispositifs et systèmes d'administration de gNO permettent un transport aisé du dispositif vers divers milieux où une intervention thérapeutique ne se prête pas à un milieu hospitalier pour patients hospitalisés. Comme illustré sur la Fig. 1, collecteurs de gaz 100 utilisés avec les dispositifs et systèmes de distribution de gNO de la présente divulgation peuvent comprendre diverses caractéristiques pour contrôler la distribution du gaz à un sujet (par exemple, des collecteurs de gaz d'ALICAT SCIENTIFIC). Par exemple, les collecteurs de gaz utilisés avec les dispositifs et systèmes de distribution de NO portables de la présente divulgation peuvent comprendre un orifice pour insérer une source d'alimentation. 115 et/ou un port pour insérer une ou plusieurs unités de batteries rechargeables (non illustrées), divers affichages numériques pour la concentration et la pression de gaz 120, diverses arrivées de gaz 125 et points de vente 130, et divers capteurs de concentration de gaz 135. Les collecteurs de gaz utilisés avec les dispositifs et systèmes de distribution de NO portables de la présente divulgation peuvent être couplés fonctionnellement à l'unité d'interface sujet pour faciliter l'administration de NO à un sujet. Divers types et modèles de collecteurs de gaz peuvent être utilisés pour délivrer du gNO sous pression à un sujet, comme le reconnaîtrait l'homme du métier ou l'homme du métier sur la base de la présente divulgation.

Dans certains modes de réalisation, les dispositifs portables de distribution de gNO de la présente divulgation comprennent une source de gNO, telle qu'un conteneur de stockage de gNO qui contient le gNO avant la distribution à un sujet. Le conteneur de stockage de gNO peut être n'importe quel réservoir ou cylindre approprié qui contient du gNO comprimé de qualité médicale pour une livraison à un sujet. Les bouteilles de stockage de gNO appropriées peuvent également être équipées de manomètres ou de régulateurs, de débitmètres ou de régulateurs, de boutons de réglage pour régler à la fois la pression de sortie et les débits, les entrées/sorties de gaz, etc. Dans certains aspects, le cylindre de gNO peut comprendre une quantité spécifique de gNO (par exemple, des litres de gNO), de sorte que la délivrance du gNO à un sujet atteint d'un certain état constitue un traitement unique. Par exemple, un cylindre de stockage de gNO peut contenir environ 9,0 litres de gNO de sorte que lorsqu'il est livré à un sujet pendant 90 minutes continues à un débit de 0,1 litre par minute (LPM), le gNO sera épuisé. Dans ce mode de fonctionnement, le cylindre de stockage de gNO peut fonctionner comme un dispositif de sécurité pour empêcher une surexposition de gNO au sujet.

Dans certains modes de réalisation, le gNO administré à un sujet fait partie d'un mélange gazeux qui a une concentration de NO allant d'environ 1 ppm à environ 1 500 ppm, d'environ 1 000 ppm à environ 5 000 ppm, d'environ 4 000 ppm à environ 10 000 ppm. , d'environ 9 000 ppm à environ 16 000 ppm, d'environ 15 000 ppm à environ 22 000 ppm, d'environ 21 000 ppm à environ 28 000 ppm, d'environ 27 000 ppm à environ 34 000 ppm et d'environ 33 000 ppm à environ 40 000 ppm. Dans certains aspects, le gNO délivré au sujet est de 10 000 ppm, soit environ 1,0 % du mélange gazeux (1 ppm correspond à environ 0,0001 %).

Dans certains modes de réalisation, le dispositif de délivrance de NO est équipé pour délivrer du gNO sous divers paramètres, y compris délivrer du gNO à diverses pressions. Dans certains aspects, le gNO peut être délivré à un sujet à des pressions comprises entre environ 0 atmosphère (ATM) et environ 1 ATM (c'est-à-dire la pression à l'intérieur de l'unité d'interface du sujet). L'administration de gNO à un sujet dans cette plage est indépendante de, et en plus de, la pression de l'environnement extérieur (par exemple, la pression barométrique). Comme le reconnaîtra l'homme de l'art sur la base de la présente divulgation, les unités de pression peuvent être exprimées en utilisant diverses mesures, y compris les guichets automatiques, les livres-force par pouce carré (par exemple, lbf/in 2 ou psi), bar ( par exemple, Mbar, kilobar, millibar, etc.), pascal (par exemple, Pa, kPa, MPa, etc.) et/ou torr (par exemple, Torr, mTorr, etc.). Par exemple, 1 ATM peut être exprimé comme 14,695 psi. Dans certains aspects de la présente divulgation, la pression peut être mesurée et exprimée en incréments qui sont des dixièmes, centièmes et/ou millièmes de ces diverses métriques. Dans certains aspects, le gNO est délivré à différentes plages. Par exemple, le gaz gNO peut être délivré à des pressions d'environ 0 ATM à environ 1,0 ATM, d'environ 0 ATM à environ 0,9 ATM, d'environ 0 ATM à environ 0,8 ATM, d'environ 0 ATM à environ 0,7 ATM, d'environ 0 ATM à environ 0,6 ATM, d'environ 0 ATM à environ 0,5 ATM, d'environ 0 ATM à environ 0,4 ATM, d'environ 0 ATM à environ 0,3 ATM, d'environ 0 ATM à environ 0,2 ATM, et d'environ 0 ATM à environ 0,1 AU M. Dans certains aspects, le gNO peut être délivré à des pressions d'environ 0,1 ATM à environ 0,5 ATM, d'environ 0,15 ATM à environ 1,0 ATM, d'environ 0,15 ATM à environ 0,5 ATM, d'environ 0,15 ATM à environ 0,25 ATM, et d'environ 0,25 ATM à environ 0,5 ATM. Dans certains aspects, le gNO peut être délivré à des pressions d'environ 0,1 ATM, environ 0,15 ATM, environ 0,2 ATM, environ 0,25 ATM, environ 0,3 ATM, environ 0,35 ATM, environ 0,4 ATM, environ 0,45 ATM, environ 0,5 ATM, environ 0,55 ATM, environ 0,6 ATM, environ 0,65 ATM, environ 0,7 ATM, environ 0,75 ATM, environ 0,8 ATM, environ 0,85 ATM, environ 0,9 ATM et environ 0,95 ATM.

FIGUES. 2A-2B sont des représentations de deux unités d'interface sujet qui se couplent au dispositif de délivrance de NO, selon un mode de réalisation de la présente divulgation. Les unités d'interface sujet sont les parties du système de délivrance de NO qui sont placées directement sur le sujet, par exemple, autour d'un site de plaie, de sorte que le NO est délivré au site de plaie. L'unité d'interface sujet comprend généralement un mécanisme de fixation pour fixer l'unité d'interface sujet sur le sujet et/ou maintenir ou créer un joint sur le sujet. Dans certains aspects, comme illustré sur la Fig. 2A , l'unité d'interface sujet 205 est en forme de coupe et comprend des sangles de montage 210 qui sont légers, faciles à manipuler et fabriqués à partir de matériaux adaptés à la fixation à un sujet. Dans certains aspects, comme illustré sur la Fig. 2B , l'unité d'interface sujet 215 est plus rigide et comprend une unité de vide périphérique (non illustrée) qui facilite l'établissement et le maintien d'un joint autour de l'orifice de distribution de NO.

Dans d'autres aspects, comme illustré sur la Fig. 2C , l'unité d'interface sujet 220 est configuré pour s'adapter autour d'une plus grande zone de l'appendice d'un sujet. L'unité d'interface sujet 220 peut être une enceinte transparente flexible qui couvre, par exemple, tout le pied ou la main d'un sujet. L'unité d'interface sujet 220 peut également être une structure rigide en forme de boîte ou cylindrique qui enferme la majeure partie de la jambe ou du bras du sujet, par exemple, et est configurée pour former un joint autour de la région la plus proximale de la jambe ou du bras. D'autres configurations de l'unité d'interface sujet et des mécanismes de fixation peuvent être utilisées afin de fixer l'unité d'interface sujet sur le sujet et d'assurer la délivrance efficace de NON au sujet. Comme le reconnaîtra l'homme du métier sur la base de la présente divulgation, de telles configurations dépendent de facteurs tels que, mais sans s'y limiter, la taille du site de traitement, son emplacement sur le sujet, le type d'infection, et le semblable.

Dans certains modes de réalisation, les dispositifs et systèmes de distribution de gNO de la présente divulgation peuvent être configurés de telle sorte que le collecteur de gaz n'est pas requis, comme illustré sur la Fig. 3 . Par exemple, le dispositif de livraison gNO 300 peut inclure une source pour le gNO 305 (par exemple, une bouteille ou un réservoir) qui est directement et fonctionnellement couplé à des mécanismes de régulation de la pression et du débit de gNO vers l'unité d'interface concernée, tel qu'un régulateur de pression de gaz 310 et/ou un régulateur de débit de gaz 315. Le dispositif de livraison gNO 300 peut également inclure des lectures ou des affichages numériques et/ou analogiques pour visualiser la pression et le débit du gNO délivré à l'unité d'interface concernée (par exemple, manomètre, débitmètre). Le dispositif de livraison gNO 300 peut également inclure des boutons de réglage fin et/ou grossier pour ajuster la pression et le débit du gNO délivré. Le dispositif de livraison gNO 300 peut également inclure des entrées de gaz 320 et sorties de gaz 325 couplés aux régulateurs de pression et de débit, ainsi qu'aux arrivées de gaz 330 et sorties de gaz 335 couplé à l'unité d'interface sujet 340.

Divers modes de réalisation du dispositif d'administration de gNO 300 peuvent offrir les avantages supplémentaires de ne pas nécessiter de collecteur ou de composants électroniques, ils peuvent donc être plus facilement déployés dans des situations médicales d'urgence. Dans certains aspects, le cylindre de gNO utilisé avec ces dispositifs de gNO peut comprendre une quantité spécifique de gNO (par exemple, des litres de gNO), de sorte que l'administration de gNO à un sujet constitue un traitement unique. Par exemple, un cylindre de stockage de gNO peut contenir environ 9,0 litres de gNO de sorte que lorsqu'il est livré à un sujet pendant 90 minutes continues à un débit de 0,1 litre par minute (LPM), le gNO sera épuisé. Dans ce mode de fonctionnement, le cylindre de stockage de gNO peut fonctionner comme une caractéristique de sécurité pour empêcher une surexposition de gNO au sujet.

Les unités d'interface en question de la présente divulgation peuvent être revêtues de substances qui aident à prévenir ou à réduire la contamination par des micro-organismes, des bactéries, des champignons, des virus et similaires. Les revêtements peuvent être des agents pharmaceutiques actifs qui réduisent la croissance et/ou la survie de ces micro-organismes nocifs (par exemple, des substances antibactériennes), et/ou les revêtements peuvent fonctionner passivement pour empêcher ou réduire la contamination, par exemple, en empêchant l'adhérence de ces micro-organisme sur les diverses surfaces des unités d'interface en question (par exemple, des agents mouillants).

Les matériaux appropriés qui peuvent être utilisés pour construire les unités d'interface sujettes de la présente divulgation comprennent, sans s'y limiter, divers matériaux plastiques et polymères, tels que le polystyrène (PS), le polycarbonate (PC), l'acrylonitrile-butadiène-styrène (ABS) , polybutylène téréphtalate (PBTP), styrène acrylonitrile (SAN), polyamide (PA), polyoxyméthylène (POM), oxyde de polyphénylène (PPO), PE, PP, PTFE et homopolymères et copolymères de ces plastiques et matériaux similaires connus dans l'art et basés sur la présente divulgation. Les matières plastiques peuvent également être utilisées sous une forme chargée ou renforcée de fibres, et/ou couplées à des portions de métaux ou d'alliages métalliques, tels que l'aluminium, le titane, l'acier et leurs combinaisons. Les matériaux utilisés pour construire les unités d'interface en question peuvent être revêtus en surface, par exemple avec des peintures, des vernis ou des laques. L'utilisation de matières plastiques colorées, par exemple colorées avec des pigments, est également possible.

Diverses autres unités d'interface sujet peuvent être construites, en fonction des caractéristiques du site de la plaie, de l'emplacement du site de la plaie, de l'état du sujet, de l'environnement dans lequel le sujet doit être traité, etc. Dans certains aspects, les diverses unités d'interface sujet peuvent être adaptées pour modéliser l'utilisation sur un sujet, mais dans un cadre in vitro, à des fins expérimentales (voir, par exemple, la figure 2C). Par exemple, une prothèse de jambe ou de bras peut être placée dans une unité d'interface sujet scellée de forme cylindrique configurée pour recevoir des cellules et/ou des tissus cultivés (par exemple, un tissu cutané de pleine épaisseur). De telles configurations peuvent être utilisées pour mener des expériences avant utilisation sur un sujet vivant réel.

Quelle que soit la configuration de l'unité d'interface du sujet, il est avantageux d'établir et de maintenir une étanchéité sur le sujet afin que le NO puisse être administré à des pressions suffisamment élevées pour apporter des avantages thérapeutiques au sujet (par exemple, réduire la charge biologique, réduire l'infection, accélérer la cicatrisation des plaies etc). Tel qu'utilisé ici, la charge biologique se réfère généralement au nombre de bactéries ou d'autres agents pathogènes présents sur une surface, par exemple, la surface d'un tissu ou d'une plaie (par exemple, la peau et/ou les os). La réduction de la biocharge est généralement corrélée à la réduction ou à la minimisation d'une infection, ainsi qu'aux divers symptômes qui accompagnent une infection (par exemple, douleur, gonflement, rougeur, odeur nauséabonde, libération de sang ou de pus, etc.). La réduction de la charge biologique et la réduction des infections ont également tendance à être corrélées à une cicatrisation accélérée des plaies, à la réparation des tissus et à la croissance des tissus sains. L'application de NO sous pression pendant une durée donnée à un débit donné peut réduire la charge biologique dans la plaie d'un sujet, ce qui à son tour favorise la cicatrisation.

Les systèmes d'administration de NO de la présente divulgation peuvent comprendre des unités d'interface sujet ayant la capacité de maintenir un joint sur un sujet lors de l'administration de NO entre environ 0,1 ATM (1,47 psi) et environ 1,0 ATM (14,695 psi). Dans certains aspects, l'administration de NO à une pression allant d'environ 0,1 ATM (1,47 psi) à environ 0,25 ATM (3,674 psi) est suffisante pour établir et maintenir une étanchéité sur la plaie d'un sujet et réduire la charge microbienne dans la plaie, accélérant ainsi la cicatrisation. . Dans d'autres aspects, l'administration de NO à une pression allant d'environ 0,1 ATM (1,47 psi) à environ 0,15 ATM (2,20 psi) est suffisante pour établir et maintenir une étanchéité sur la plaie d'un sujet et pour réduire la charge microbienne dans la plaie, accélérant ainsi guérison. L'administration de NO dans ces plages de pression est suffisante pour réduire la charge biologique sans compromettre de manière significative la viabilité des cellules et des tissus du sujet.

Dans certains modes de réalisation, les systèmes d'administration de NO de la présente divulgation peuvent être utilisés pour administrer du NO au site de la plaie d'un sujet à un certain débit. Comme le reconnaîtra l'homme du métier sur la base de la présente divulgation, les unités de débit peuvent être exprimées en utilisant diverses mesures, y compris les litres/minute (LPM) et/ou les centimètres cubes par minute (cm 3 /min ou cc /min). Par exemple, le NO peut être administré à un sujet à un débit allant d'environ 0,1 litre/minute à environ 2,0 litres/minute, d'environ 0,1 litre/minute à environ 1,9 litre/minute, d'environ 0,1 litre/minute à environ 1,8 litres/minute, d'environ 0,1 litre/minute à environ 1,7 litre/minute, d'environ 0,1 litre/minute à environ 1,6 litre/minute, d'environ 0,1 litre/minute à environ 1,5 litre/minute, d'environ 0,1 litre/minute à environ 1,4 litre/minute, d'environ 0,1 litre/minute à environ 1,3 litre/minute, d'environ 0,1 litre/minute à environ 1,2 litre/minute, d'environ 0,1 à environ 1,1 litre/minute, d'environ 0,1 litre/minute à environ 1,0 litre/minute, d'environ 0,1 litre/minute à environ 0,9 litre/minute, d'environ 0,1 litre/minute à environ 0,8 litre/minute, d'environ 0,1 litre/minute à environ 0,7 litre/minute, d'environ 0,1 litre/minute à environ 0,6 litre/minute, d'environ 0,1 litre/minute à environ 0,5 litre/minute, d'environ 0,1 litre/minute à un environ 0,4 litre/minute, d'environ 0,1 litre/minute à environ 0,3 litre/minute, et d'environ 0,1 litre/minute à environ 0,2 litre/minute. Dans certains aspects, le NO peut être délivré à un sujet à un débit d'environ 0,1 litre/minute, environ 0,2 litre/minute, environ 0,3 litre/minute, environ 0,4 litre/minute, environ 0,5 litre/minute, environ 0,6 litre /minute, environ 0,7 litre/minute, environ 0,8 litre/minute et environ 0,9 litre/minute, environ 1,0 litre/minute, environ 1,2 litre/minute, environ 1,3 litre/minute, environ 1,4 litre/minute, environ 1,5 litre/ minute, environ 1,6 litre/minute, environ 1,7 litre/minute, environ 1,8 litre/minute, environ 1,9 litre/minute et environ 2,0 litres/minute, ou équivalent.

Dans certains modes de réalisation, les systèmes d'administration de NO de la présente divulgation peuvent être utilisés pour administrer du NO au site de la plaie d'un sujet pendant une certaine période de temps. Par exemple, le NO peut être administré à un sujet pendant une période allant d'environ 30 minutes à environ 180 minutes, d'environ 30 minutes à environ 170 minutes, d'environ 30 minutes à environ 160 minutes, d'environ 30 minutes à environ 150 minutes, d'environ 30 minutes à environ 140 minutes, d'environ 30 minutes à environ 130 minutes, d'environ 30 minutes à environ 120 minutes, d'environ 30 minutes à environ 110 minutes, d'environ 30 minutes à environ 90 minutes, d'environ 30 minutes à environ 80 minutes, d'environ 30 minutes à environ 70 minutes, d'environ 30 minutes à environ 60 minutes, d'environ 30 minutes à environ 50 minutes et d'environ 30 minutes à environ 40 minutes. Dans certains aspects, le NO peut être délivré à un sujet pendant une période d'environ 110 minutes, environ 105 minutes, environ 100 minutes, environ 95 minutes, environ 90 minutes, environ 85 minutes, environ 80 minutes, environ 75 minutes, environ 70 minutes, environ 65 minutes, environ 60 minutes, environ 55 minutes, environ 50 minutes, environ 45 minutes, environ 40 minutes, environ 35 minutes, environ 30 minutes, environ 25 minutes, environ 20 minutes, environ 15 minutes, environ 10 minutes , et environ 5 minutes, ou selon ce qui est jugé approprié pour le sujet et la plaie examinés.

Dans certains modes de réalisation, les dispositifs et systèmes de délivrance de NO de la présente divulgation peuvent comprendre un ou plusieurs capteurs de gaz (par exemple, des capteurs électrochimiques) pour mesurer la concentration d'un ou plusieurs gaz délivrés au sujet (figure 1, 135). Par exemple, les systèmes d'administration de la présente divulgation peuvent comprendre des capteurs d'oxyde nitrique, des capteurs de dioxyde nitrique et/ou des capteurs d'oxygène. Ces capteurs peuvent être couplés fonctionnellement à la source du gaz (par exemple, un réservoir ou une bouteille de NO) et/ou ils peuvent être couplés à l'unité d'interface en question pour mesurer les concentrations de gaz sur le site de la plaie ou de l'infection. Dans certains aspects, les capteurs de gaz peuvent aider à maintenir un débit et une concentration de NO constants sur une période de traitement donnée. Dans certains aspects, les capteurs peuvent indiquer à un utilisateur (par exemple, un fournisseur de soins de santé) que la concentration du gaz est supérieure ou inférieure à un seuil prescrit pour un protocole de traitement donné pour un sujet, auquel cas l'utilisateur peut ajuster un ou plusieurs paramètres, tels que le régulateur de pression de gaz ou le régulateur de débit de gaz, ou l'utilisateur peut arrêter le traitement et remplacer la source du gaz par une autre ayant les concentrations de gaz appropriées. Dans d'autres aspects, les capteurs de gaz peuvent être utilisés dans le cadre d'un protocole pour purger le système, y compris l'unité d'interface sujet, de l'oxygène, de sorte que le gNO puisse être délivré à un sujet d'une manière sensiblement exempte d'oxygène. Par exemple, un flux continu de gNO et/ou un bolus de gNO peut être délivré à un sujet via l'unité d'interface sujet tandis qu'un capteur d'oxygène mesure la concentration décroissante d'oxygène dans l'unité d'interface sujet. Une fois que le capteur indique que peu ou pas d'oxygène est présent dans le système, le protocole de traitement gNO peut commencer.

De plus, les dispositifs et systèmes d'administration de NO de la présente divulgation peuvent comprendre un mécanisme de rinçage. Dans certains aspects, le mécanisme de rinçage peut être utilisé pour éliminer le NO utilisé pendant le traitement et restaurer les niveaux d'oxygène à la normale de sorte que le sujet ne soit pas exposé à des niveaux élevés de NO après le retrait de l'unité d'interface sujet. Le mécanisme de rinçage peut être couplé à la source de gaz NO, de sorte qu'un utilisateur peut remplacer la source de gNO utilisée pour le traitement par une source de gaz ayant une concentration plus faible de NO et une concentration plus élevée d'oxygène (par exemple, une bouteille ayant une air ambiant comprimé ou oxygène pur). Dans certains aspects, l'utilisateur peut ensuite activer le mécanisme de rinçage pour déplacer le gNO précédemment administré hors de l'unité d'interface sujet. Le mécanisme de rinçage peut être exécuté selon un protocole prescrit, par exemple, le gaz de rinçage peut être administré sur une certaine durée pendant que l'unité d'interface sujet est toujours attachée au sujet. Dans certains aspects, le mécanisme de rinçage peut comprendre l'injection d'un bolus d'air ou d'oxygène purifié dans le dispositif d'administration peu après la fin du traitement par gNO. Dans ce mode de fonctionnement, un protocole de rinçage n'est pas nécessaire de manière significative, car le bolus d'air sera injecté et traversera rapidement le dispositif d'administration. D'autres protocoles de rinçage peuvent être utilisés selon les normes et pratiques médicales acceptées, comme le reconnaîtra l'homme du métier sur la base de la présente divulgation.

Des modes de réalisation des systèmes d'administration de NO de la présente divulgation peuvent être utilisés pour soulager des symptômes de maladie ou des états de santé et améliorer les résultats thérapeutiques chez un sujet concernant des plaies. Par exemple, les systèmes d'administration de NO de la présente divulgation peuvent être utilisés pour traiter des sujets ayant des problèmes de santé, par exemple, le diabète sucré, car ces sujets sont connus pour être à risque de développer des ulcères cutanés aigus et chroniques (par exemple, des ulcères du pied ), en présence de complications établies à long terme de l'état de santé ou de la maladie. Les infections dues aux ulcères diabétiques peuvent aller de la paronychie superficielle aux infections profondes impliquant les os. Il est envisagé ici que n'importe lequel et tous ces types d'ulcères puissent être traités en utilisant les systèmes et procédés de la présente divulgation. Dans certains modes de réalisation, les types d'infection peuvent inclure, mais sans s'y limiter, la cellulite, la myosite, les abcès, la fasciite nécrosante, l'arthrite septique, la tendinite et l'ostéomyélite.

De plus, des modes de réalisation des systèmes d'administration de NO de la présente divulgation peuvent être utilisés pour traiter les infections de la peau et des tissus mous (SSTI). Les SSTI sont courantes et les SSTI compliquées (cSSTI) peuvent être l'extrémité la plus extrême de cette indication. Les SSTI peuvent englober une gamme de présentations cliniques, y compris, mais sans s'y limiter, une infection profonde, qui nécessite généralement une intervention chirurgicale, la présence de signes systémiques de septicémie, la présence de comorbidités compliquantes, la neutropénie associée, l'ischémie associée, la nécrose des tissus , brûlures et morsures. Staphylococcus aureus est la cause la plus fréquente des SSTI, cependant, son épidémiologie (par exemple, les souches causales) et sa sensibilité aux antibiotiques ne peuvent actuellement pas être prédites avec précision. Il est envisagé que les systèmes et procédés décrits ici puissent être utilisés pour réduire le risque de SSTI ainsi que pour les traiter.

Divers modes de réalisation des systèmes d'administration de NO décrits dans la présente demande peuvent fournir les moyens de minimiser l'infection en réduisant la charge biologique à l'aide de gNO sous pression administré à un site de plaie. Contrairement aux traitements liés aux antibiotiques contre les organismes pathogènes tels que les bactéries, les bactéries sont incapables de développer une résistance au gNO. Par conséquent, les systèmes d'administration de NO de la présente description représentent un moyen universellement efficace pour traiter et/ou prévenir les infections en réduisant la charge biologique dans une plaie et en accélérant la cicatrisation. Des modes de réalisation de la présente demande concernant les systèmes d'administration de NO peuvent être utilisés pour réduire les infections déjà présentes chez un sujet, et/ou utilisés à titre prophylactique pour empêcher le développement d'une infection pathogène, par exemple, en étant appliqués sur le site d'une plaie chirurgicale ou d'une incision. De plus, le gNO délivré à l'aide des systèmes et dispositifs de la présente divulgation peut être utilisé pour traiter une infection dans un large éventail de plaies et d'indications de maladie chez un sujet, y compris, mais sans s'y limiter, les sites d'infections pathogènes telles que les infections bactériennes, les infections fongiques , infections virales, infections à protozoaires, brûlures, plaies, rides, lésions, etc. Les lésions peuvent inclure, sans s'y limiter, une plaie chirurgicale, une plaie traumatique, une brûlure, un abcès, une kératose actinique, une chéloïde, une cicatrice et un cancer de la peau et une combinaison de ceux-ci.

De plus, des modes de réalisation de la présente divulgation concernant des systèmes d'administration de NO comprennent des utilisations en combinaison avec d'autres thérapies pour soulager les symptômes de la maladie et améliorer les résultats thérapeutiques chez un sujet ayant besoin d'un tel traitement. Par exemple, dans le cas de l'ostéomyélite, l'administration de NO selon les modes de réalisation de la présente divulgation peut être combinée avec d'autres méthodes de traitement connues, y compris, mais sans s'y limiter, l'administration d'antibiotiques, l'oxygénothérapie hyperbare (HBO), la thérapie de débridement des asticots et la colonie de granulocytes. -administration de facteur stimulant. Dans certains aspects, la thérapie combinatoire peut avoir des effets synergiques et peut empêcher la nécessité d'une intervention chirurgicale plus sérieuse, telle que l'amputation.

Des exemples de la présente divulgation sont inclus pour démontrer certains modes de réalisation présentés ici. Il devrait être apprécié par l'homme du métier que les techniques décrites dans les exemples qui suivent représentent des techniques découvertes pour bien fonctionner dans les pratiques décrites ici. Cependant, l'homme du métier devrait, à la lumière de la présente divulgation, apprécier que de nombreux changements peuvent être apportés aux certains modes de réalisation qui sont divulgués et obtenir toujours un résultat similaire ou similaire sans s'écarter de l'esprit et de la portée ici.

FIGUE. 4 est un graphique illustrant les effets d'un traitement au NO sur la charge biologique en utilisant un test d'infection, après trois heures d'infection, selon un mode de réalisation de la présente divulgation. Échantillons de peau infectés pendant 3 heures avec Staphylocoque, SARM, Acinetobacter ou Pseudomonas et ensuite exposé à 1 % de gNO à 1 ATM (14,695 psi) pendant 90 minutes à un débit de 0,1 litre/minute. Staphylococcus aureus, sous-espèce aureus Rosenbach (ATCC#12600) Staphylococcus aureus, sous-espèce aureus Rosenbach (ATCC#33591), souche résistante à la méthicilline de Staphylococcus aureus, lysotype 92 Acinetobacter baumannii (ATCC # BAA-747) et Pseudomonas aeruginosa (ATTC# BAA-47). Témoin = tissu infecté non traité. Trois séries de triples ont été réalisées par expérience.

Comme illustré sur la Fig. 4, un traitement comprenant 1 % de gNO à 1 ATM (14,695 psi) pendant 90 minutes a considérablement réduit la biocharge dans chacun des quatre types de bactéries testées. S. aureus a été réduit de 5 fois et les autres souches bactériennes ont été presque complètement éradiquées. Ces résultats démontrent l'efficacité de l'administration de NO pour réduire l'infection en réduisant la charge biologique dans la plaie d'un sujet. De plus, étant donné que ces expériences ont été réalisées en utilisant un modèle d'infection aiguë de 3 heures, ces données indiquent également qu'aucun traitement selon les paramètres thérapeutiques ci-dessus ne peut être utilisé pour prévenir les infections ainsi que pour traiter les infections.

Réduction de la biocharge à des pressions inférieures à 1,0 ATM

Des expériences ont également été menées pour déterminer la capacité de réduction des infections de l'administration de gNO à diverses pressions inférieures à 1,0 ATM (14,695 psi) (indépendamment de et en plus de la pression appliquée par l'environnement externe) en utilisant à la fois un dispositif de culture de tissus cellulaires de Franz (c'est-à-dire, 3-Ring) et un dispositif de livraison de NO portable (c'est-à-dire un dispositif de jambe). Les résultats d'une série d'expériences sont illustrés ci-dessous dans le tableau 1. Le NO a été administré à une concentration de 1 % après 24 heures d'infection par S. aureus. Les débits (cm 3 /min ou cc) variaient d'environ 100 à environ 1500, le débit de purge (litres/min ou LPM) variait d'environ 0,1 à environ 1,5, et le temps d'exposition au NO variait entre environ 45 minutes et environ 105 minutes parmi les différents groupes de traitement et témoins. Les comptages de colonies (log CFU) ont été effectués à diverses dilutions, qui sont représentées dans les huit dernières colonnes étiquetées 0, 1 × 10 -1 à 1 × 10 -7 (« 0 » indique aucune dilution). Les résultats du tableau 1 démontrent que la charge biologique était significativement réduite (c'est-à-dire, la destruction totale) après l'administration de NO à des pressions aussi basses qu'environ 0,15 ATM (2,2 psi) pour des temps d'exposition d'environ 105 minutes.

De plus, des tests MTT ont été effectués pour évaluer la viabilité cellulaire après l'administration de NO. Les tests MTT sont des tests colorimétriques utilisés pour évaluer la viabilité cellulaire en fonction de la variation de couleur. Comme illustré ci-dessous dans le tableau 2, la viabilité cellulaire après l'administration de NO sous pression à environ 0,15 ATM (2,2 psi) pendant environ 105 minutes variait d'environ 40 % à 50 %. Par conséquent, l'administration de NO à des pressions inférieures à 1,0 ATM (14,695 psi) est efficace pour réduire la biocharge et ne compromet pas de manière significative la viabilité cellulaire.

Les résultats des tableaux 2 et 3 indiquent que le NO peut être délivré à des pressions inférieures à 1,0 ATM (14,695 psi) (indépendamment de et en plus de la pression appliquée par l'environnement externe) et réduire efficacement l'infection en réduisant la charge microbienne sans compromettre de manière significative la santé des les cellules du sujet. L'utilisation de pressions inférieures à 1,0 ATM (14,695 psi) a l'avantage supplémentaire de nécessiter moins de pression externe sur l'unité d'interface en question pour maintenir une étanchéité, rendant ainsi l'étanchéité plus facile à établir et à maintenir, tout en offrant un plus grand degré de confort pour l'objet. Trouver l'équilibre entre la délivrance de NO à une pression suffisamment élevée pour réduire la charge biologique tout en maintenant une étanchéité efficace sur le sujet est une contribution importante de la présente divulgation.

FIGUES. 5A-5C sont des coupes histologiques représentatives colorées pour détecter la présence de la bactérie S. aureus sur un échantillon de tissu cutané traité et non traité, selon un mode de réalisation de la présente invention. FIGUE. 5A a été prélevé sur des tissus blessés mais non infectés. FIGUE. 5B a été prélevé sur des tissus blessés et infectés pendant 3 heures avec S. aureus. FIGUE. 5C a été prélevé sur des tissus qui ont été blessés et infectés pendant 24 heures avec S. aureus. Les coupes histologiques représentatives ont été colorées au Giesma, qui identifie S. aureus bactéries présentes dans le tissu de l'échantillon de peau. S. aureus des bactéries pouvaient être observées à la surface de la plaie après 3 heures d'infection, mais après 24 heures d'infection, les bactéries s'étaient infiltrées davantage dans les tissus.

Détection Biofilm Production par de S. aureus dans Infections cutanées

Les biofilms peuvent jouer un rôle en histopathologie et sont des structures complexes constituées de cellules bactériennes intégrées dans une matrice extracellulaire contenant des polysaccharides, des protéines et de l'ADN. La matrice de biofilm peut limiter l'efficacité du traitement antibiotique topique dans les plaies infectées et peut entraver la cicatrisation des plaies et les réponses immunitaires. Les divers composants du biofilm et de la matrice extracellulaire associée peuvent être visualisés à l'aide de techniques histologiques et peuvent fournir une base pour évaluer l'efficacité de l'administration de NO pour réduire la charge microbienne des bactéries qui forment des biofilms.

FIGUES. 6A-6F sont des coupes histologiques représentatives colorées pour détecter les composants du biofilm bactérien, selon un mode de réalisation de la présente divulgation. Les échantillons de peau utilisés dans les Fig. 6A-6F ont été infectés pendant 24 heures avec S. aureus bactéries, puis fixées dans du formol, incorporées et tranchées par incréments de 5-6 um. FIGUE. 6A a été prélevé sur des tissus colorés à l'hématoxyline et à l'éosine. FIGUE. 6B a été prélevé sur du tissu coloré par réaction de Feulgen. FIGUE. Le 6C a été prélevé sur des tissus colorés au rouge Congo modifié. FIGUE. 6D a été prélevé sur des tissus colorés avec du rouge Congo modifié avec du carbol fuchsine. FIGUE. 6E a été prélevé sur des tissus colorés au PAS. FIGUE. Le 6F est coloré au Calcofluor. En utilisant ces techniques histologiques, un échantillon de tissu cutané peut être prélevé avant et après le traitement avec du NO sous pression pour déterminer les réductions de la charge microbienne pour les bactéries qui forment un biofilm.

La présente divulgation, dans divers aspects, modes de réalisation et configurations, comprend des composants, des procédés, des processus, des systèmes et/ou des appareils sensiblement tels qu'illustrés et décrits ici, y compris divers aspects, modes de réalisation, configurations, sous-combinaisons et sous-ensembles de ceux-ci. L'homme du métier comprendra comment fabriquer et utiliser les divers aspects, aspects, modes de réalisation et configurations, après avoir compris la présente divulgation. La présente divulgation, dans divers aspects, modes de réalisation et configurations, comprend la fourniture de dispositifs et de processus en l'absence d'éléments non représentés et/ou décrits ici ou dans divers aspects, modes de réalisation et configurations de celui-ci, y compris en l'absence d'éléments pouvant ont été utilisés dans des dispositifs ou processus antérieurs, par exemple, pour améliorer les performances, faciliter et/ou réduire les coûts de mise en œuvre.

La discussion précédente de la divulgation a été présentée à des fins d'illustration et de description. Ce qui précède n'est pas destiné à limiter la divulgation à la forme ou aux formes divulguées dans les présentes. Dans la description détaillée qui précède, par exemple, diverses caractéristiques de la divulgation sont regroupées en un ou plusieurs aspects, modes de réalisation et configurations dans le but de rationaliser la divulgation. Les caractéristiques des aspects, modes de réalisation et configurations de la divulgation peuvent être combinées dans d'autres aspects, modes de réalisation et configurations autres que ceux décrits ci-dessus. Cette méthode de divulgation ne doit pas être interprétée comme reflétant une intention selon laquelle la divulgation revendiquée nécessite plus de caractéristiques que celles expressément énoncées dans chaque revendication. Au lieu de cela, comme le reflètent les revendications suivantes, les aspects inventifs se situent dans moins que toutes les caractéristiques des seuls aspects, modes de réalisation et configurations décrits ci-dessus. Ainsi, les revendications suivantes sont incorporées dans la présente description détaillée, chaque revendication étant indépendante en tant que mode de réalisation préféré séparé de la divulgation.

De plus, bien que la description de la divulgation ait inclus la description d'un ou plusieurs aspects, modes de réalisation ou configurations et certaines variations et modifications, d'autres variations, combinaisons et modifications sont dans la portée de la divulgation, par exemple, comme cela peut être dans la compétence et la connaissance de l'homme de l'art, après avoir compris la présente divulgation. Il est destiné à obtenir des droits qui incluent des aspects, des modes de réalisation et des configurations alternatifs dans la mesure permise, y compris des structures, des fonctions, des gammes ou des étapes alternatives, interchangeables et/ou équivalentes à celles revendiquées, que ces alternatives, interchangeables et/ou équivalentes soient ou non des structures, des fonctions, des gammes ou des étapes sont divulguées ici, et sans intention de dédier publiquement un objet brevetable.


Réclamations

1. Méthode de traitement du cancer comprenant :

l'administration intratumorale d'une dose thérapeutiquement efficace d'un vaccin à un sujet en ayant besoin.

2. Procédé selon la revendication 1, dans lequel le vaccin est un vaccin monovalent ou un vaccin multivalent.

3. Procédé selon la revendication 1, dans lequel le vaccin est un vaccin antigrippal.

4. Procédé selon la revendication 3, dans lequel le vaccin antigrippal est un vaccin antigrippal saisonnier.

5. Méthode selon l'une quelconque des revendications précédentes, caractérisée en ce que le vaccin est choisi dans le groupe constitué par le DTaP (diphtérie, coqueluche et tétanos), le Pneumovax (Pneumococcal Pneumonia), HepB (hépatite B) et le MMR (rougeole, oreillons, rubéole).

6. Procédé selon la revendication 1, dans lequel le vaccin antigrippal est un vaccin approuvé par la FDA.

7. Procédé selon l'une quelconque des revendications précédentes, dans lequel des doses multiples du vaccin sont administrées.

8. Méthode selon l'une quelconque des revendications précédentes, caractérisée en ce que l'administration intratumorale se fait par injection ou lors d'une procédure de biopsie.

9. Procédé selon l'une quelconque des revendications précédentes, dans lequel le vaccin est inactivé.

10. Procédé selon l'une quelconque des revendications précédentes, dans lequel le vaccin est sans adjuvant.

11. Méthode selon l'une quelconque des revendications précédentes, dans laquelle le cancer est choisi dans le groupe constitué par le mélanome, le poumon non à petites cellules, le poumon à petites cellules, le poumon, l'hépatocarcinome, le rétinoblastome, l'astrocytome, le glioblastome, la leucémie, le neuroblastome, la tête, le cou, sein, pancréatique, prostate, rénal, os, testiculaire, ovarien, mésothéliome, cervical, gastro-intestinal, urogénital, voies respiratoires, hématopoïétique, musculo-squelettique, neuroendocrinien, carcinome, sarcome, système nerveux central, système nerveux périphérique, lymphome, cerveau, côlon ou vessie cancer.

12.Procédé selon la revendication 1, comprenant en outre l'administration d'au moins un traitement anticancéreux supplémentaire.

13. Procédé selon la revendication 12, dans lequel le au moins un traitement anticancéreux supplémentaire est une thérapie chirurgicale, une chimiothérapie, une radiothérapie, une thérapie hormonale, une immunothérapie, une thérapie par petites molécules, une thérapie par inhibiteur de récepteur kinase, une thérapie anti-angiogénique, une thérapie par cytokine, une cryothérapie, une radioablation ou une thérapie biologique.

14. Procédé selon la revendication 12, dans lequel le au moins un traitement anticancéreux supplémentaire est un inhibiteur de point de contrôle immunitaire.

15. Procédé selon la revendication 14, dans lequel l'au moins un inhibiteur de point de contrôle est choisi parmi un inhibiteur de la mort programmée des cellules T 1 (PD-1), du ligand de mort programmée des cellules T 1 (PD-L1), de la PDL-2, du cytotoxique T. -antigène lymphocytaire 4 (CTLA-4), gène d'activation lymphocytaire 3 (LAG-3), Tim-3, CD28, CD122 ou CD137.

16. Procédé selon la revendication 15, dans lequel l'au moins un inhibiteur de point de contrôle est un anticorps anti-PD-1, un anticorps anti-PD-L1, un anticorps anti-PD-L2, un anticorps anti-CTLA4 ou un anticorps anti-LAG3.

17. Méthode selon la revendication 16, dans laquelle l'anticorps anti-PD-1 est choisi dans le groupe consistant en nivolumab, pembrolizumab, pidilizumab, AMP-514, REGN2810, CT-011, BMS 936559, MPDL3280A et AMP-224, dans lequel le l'anticorps anti-PD-L1 est choisi dans le groupe constitué du durvalumab, de l'atezolizumab et de l'avelumab et dans lequel l'anticorps anti-CTLA-4 est le tremelimumab ou l'ipilimumab.

18. Méthode selon la revendication 14, dans laquelle plus d'un inhibiteur de point de contrôle est administré.

19. Méthode d'augmentation d'une réponse immunitaire dans une tumeur, la méthode comprenant :

l'administration intratumorale d'une dose thérapeutiquement efficace d'un vaccin antigrippal à un sujet en ayant besoin.

20. Procédé selon la revendication 19, dans lequel le vaccin antigrippal est un vaccin non promoteur de cellules B.


Les références

Matteucci, M.D. & Caruthers, M.H. Synthèse de désoxyoligonucléotides sur un support polymère. Confiture. Chem. Soc. 103, 3185–3191 (1981).

Saiki, R.K. et al. Amplification enzymatique de l'ADN dirigée par une amorce avec une ADN polymérase thermostable. Science 239, 487–491 (1988).

Hutchison, C.A. et al. Mutagenèse à une position spécifique dans une séquence d'ADN. J. Biol. Chem. 253, 6551–6560 (1978).

Heim, R. & Tsien, R. Y. Ingénierie de la protéine fluorescente verte pour une luminosité améliorée, des longueurs d'onde plus longues et un transfert d'énergie de résonance de fluorescence. Cour. Biol. 6, 178–182 (1996).

Barbas, C.F., Kang, A.S., Lerner, R.A. & Benkovic, S.J. Assemblage de bibliothèques d'anticorps combinatoires sur les surfaces de phage : le site du gène III. Proc. Natl Acad. Sci. Etats-Unis 88, 7978–7982 (1991).

Wang, L., Brock, A., Herberich, B. & amp Schultz, P. G. Élargir le code génétique d'Escherichia coli. Science 292, 498–500 (2001).

Lerner, R.A., Benkovic, S.J. & Schultz, P.G. Au carrefour de la chimie et de l'immunologie : anticorps catalytiques. Science 252, 659–667 (1991).

Siegel, J.B. et al. Conception informatique d'un catalyseur enzymatique pour une réaction bimoléculaire stéréosélective de Diels-Alder. Science 329, 309–313 (2010).

Wang, L. et al. Génomique synthétique : de la synthèse d'ADN à la conception du génome. Angew. Chem. Int. Éd. 57, 1748–1756 (2018).

Gibson, D.G. et al. Création d'une cellule bactérienne contrôlée par un génome synthétisé chimiquement. Science 329, 52–56 (2010).

Annaluru, N. et al. Synthèse totale d'un chromosome eucaryote concepteur fonctionnel. Science 344, 55–58 (2014).

Naldini, L. La thérapie génique revient sur le devant de la scène. La nature 526, 351–360 (2015).

Dunbar, C.E. et al. La thérapie génique arrive à maturité. Science 359, eaan4672 (2018).

Sheridan, C. La thérapie génique trouve son créneau. Nat. Biotechnologie. 29, 121–128 (2011).

Jenks, S. La mort par thérapie génique – « tout le monde doit partager la culpabilité ». J. Natl Cancer Inst. 92, 98–100 (2000).

Wang, T., Upponi, J. R. & Torchilin, V. P. Conception de vecteurs de gènes non viraux multifonctionnels pour surmonter les barrières physiologiques : dilemmes et stratégies. Int. J. Pharm. 427, 3–20 (2012).

Juliano, R. L. La livraison d'oligonucléotides thérapeutiques. Acides nucléiques Res. 44, 6518–6548 (2016).

Yin, H. et al. Vecteurs non viraux pour la thérapie génique. Nat. le révérend Genet. 15, 541–555 (2014).

Hill, A. B., Chen, M., Chen, C. K., Pfeifer, B. A. & Jones, C. H. Surmonter les obstacles à la délivrance de gènes : considérations physiologiques pour les vecteurs non viraux. Tendances Biotechnol. 34, 91–105 (2016).

Giacca, M. & Zacchigna, S. Livraison de gènes à médiation virale pour la thérapie génique humaine. J. Contrôle. Sortie 161, 377–388 (2012).

Merten, O. W. & Gaillet, B. Vecteurs viraux pour les approches de thérapie génique et de modification génique. Biochimie. Ing. J. 108, 98–115 (2016).

Melchiorri, D. et al. Évaluation réglementaire de Glybera en Europe — deux comités, une mission. Nat. Rev. Drug Discov. 12, 719 (2013).

Peng, Z. Statut actuel de la gendicine en Chine : agent recombinant humain Ad-p53 pour le traitement des cancers. Hum. Gene Ther. 16, 1016–1027 (2005).

Russell, S. et al. Efficacité et sécurité du voretigene neparvovec (AAV2-hRPE65v2) chez les patients atteints de dystrophie rétinienne héréditaire médiée par RPE65 : un essai de phase 3 randomisé, contrôlé, en ouvert. Lancette 390, 849–860 (2017).

Kaiser, J. Une seconde chance. Science 358, 582–585 (2017).

Senior, M. Après le retrait de Glybera, quelle est la prochaine étape pour la thérapie génique ? Nat. Biotechnologie. 35, 491–492 (2017).

Hajj, K. A. & amp Whitehead, K. A. Outils de traduction : matériaux non viraux pour l'administration d'ARNm thérapeutique. Nat. Révérend Mater. 2, 17056 (2017).

Kaczmarek, J. C., Kowalski, P. S. & amp Anderson, D. G. Avancées dans la délivrance de thérapies à base d'ARN : du concept à la réalité clinique. Génome Med. 9, 60 (2017).

Reichmuth, A. M., Oberli, M. A., Jaklenec, A., Langer, R. & Blankschtein, D. livraison de vaccins à ARNm à l'aide de nanoparticules lipidiques. Là. Livr. 7, 319–334 (2016).

Stanton, M. G. État actuel des systèmes d'administration d'ARN messager. Acide nucléique. Là. 28, 158–165 (2018).

Hartung, T. & Daston, G. Les tests in vitro sont-ils adaptés à un usage réglementaire ? Toxicol. Sci. 111, 233–237 (2009).

Khvorova, A. & Watts, J. K. L'évolution chimique des thérapies oligonucléotidiques d'utilité clinique. Nat. Biotechnologie. 35, 238–248 (2017). Cette revue fournit un aperçu complet des modifications chimiques des oligonucléotides d'intérêt médical.

Kumar, S.R., Markusic, D.M., Biswas, M., High, K.A. & Herzog, R.W. Développement clinique de la thérapie génique : résultats et enseignements des succès récents. Mol. Là. Méthodes Clin. Dév. 3, 16034 (2016).

Ginn, S. L., Amaya, A. K., Alexander, I. E., Edelstein, M. & Abedi, M. R. Essais cliniques de thérapie génique dans le monde jusqu'en 2017 : une mise à jour. J. Gene Med. 20, e3015 (2018).

Stein, C. A. & amp Castanotto, D. Thérapies oligonucléotidiques approuvées par la FDA en 2017. Mol. Là. 25, 1069–1075 (2017).

Zuckerman, J. E. & amp Davis, M. E. Expériences cliniques avec des thérapies à base de siARN administrées de manière systémique dans le cancer. Nat. Rev. Drug Discov. 14, 843–856 (2015).

Barata, P., Sood, A. K. & Hong, D. S. Thérapie ciblée sur l'ARN dans les essais cliniques sur le cancer : état actuel et orientations futures. Traitement contre le cancer. Tour. 50, 35–47 (2016).

Adams, D. et al. Patisiran, un ARNi thérapeutique, pour l'amylose héréditaire à transthyrétine. N. Engl. J. Méd. 379, 11–21 (2018).

Stein, C.A. et al. Silençage génique efficace par livraison d'oligonucléotides antisens d'acide nucléique verrouillés, sans l'aide de réactifs de transfection. Acides nucléiques Res. 38, e3 (2010).

Goyenvalle, A. et al. Correction fonctionnelle dans des modèles murins de dystrophie musculaire à l'aide d'oligomères tricyclo-ADN à saut d'exon. Nat. Méd. 21, 270–275 (2015).

Geary, R. S., Baker, B. F. & Crooke, S. T. Pharmacocinétique et pharmacodynamique cliniques et précliniques du mipomersen (Kynamro®) : un inhibiteur oligonucléotidique antisens de deuxième génération de l'apolipoprotéine B. Clin. Pharmacokinet. 54, 133–146 (2015).

Souleimanian, N. et al. Oligonucléotides antisens 2'-désoxy, 2'-fluoroarabino nucléique (2'F-ANA) : silencieux gymnotiques in vitro de l'expression des gènes dont la puissance est renforcée par les acides gras. Mol. Là. Acides nucléiques 1, e43 (2012).

Azad, R. F., Brown-Driver, V., Buckheit, R. W. & amp Anderson, K. P. Activité antivirale d'un oligonucléotide phosphorothioate complémentaire de l'ARN du cytomégalovirus humain lorsqu'il est utilisé en combinaison avec des analogues nucléosidiques antiviraux. Antiviral Res. 28, 101–111 (1995).

Chi, X., Gatti, P. & Papoian, T. Sécurité des thérapies à base d'oligonucléotides antisens et d'ARNsi. Drogue Discov. Aujourd'hui 22, 823–833 (2017).

Shen, W. et al. L'hépatotoxicité aiguë des oligonucléotides phosphorothioates de 5-10-5 gapmer 2ʹ modifiés par fluoro chez la souris est en corrélation avec la liaison aux protéines intracellulaires et la perte de protéines DBHS. Acides nucléiques Res. 46, 2204–2217 (2018).

Burdick, A.D. et al. Motifs de séquence associés à l'hépatotoxicité de l'acide nucléique verrouillé — oligonucléotides antisens modifiés. Acides nucléiques Res. 42, 4882–4891 (2014).

Fuertes, A., Juanes, M., Granja, J. R. & Monténégro, J. Assemblages fonctionnels supramoléculaires: transporteurs membranaires dynamiques et composites nanotubulaires peptidiques. Chem. Commun. 53, 7861–7871 (2017).

Meade, B.R. et al. Livraison efficace de promédicaments ARNi contenant des modifications réversibles du squelette phosphotriester neutralisant la charge. Nat. Biotechnologie. 32, 1256–1261 (2014). Cette étude présente une méthode pour la production efficace de dérivés d'acide nucléique phosphotriester qui ont d'excellentes propriétés de ciblage et de livraison.

McNamara, J.O. et al. Livraison spécifique au type de cellule de siRNA avec des chimères aptamère-siRNA. Nat. Biotechnologie. 24, 1005–1015 (2006).

Shu, D. et al. Administration systémique d'anti-miARN pour la suppression du cancer du sein triple négatif en utilisant la nanotechnologie d'ARN. ACS Nano 9, 9731–9740 (2015).

Ren, K. et al. Une stratégie à double verrouillage et clé d'ADN pour la livraison d'ARNsi spécifique à un sous-type de cellule. Nat. Commun. 7, 13580 (2016).

Schmidt, K. et al. Caractérisation de l'effet de GalNAc et du squelette phosphorothioate sur la liaison d'oligonucléotides antisens au récepteur des asialoglycoprotéines. Acides nucléiques Res. 45, 2294–2306 (2017).

Tanowitz, M. et al. Le récepteur 1 de l'asialoglycoprotéine médie l'absorption productive d'oligonucléotides antisens phosphorothioate conjugués et non conjugués à la N-acétylgalactosamine dans les hépatocytes du foie. Acides nucléiques Res. 45, 12388–12400 (2017).

Zlatev, I. et al. Inversion du silençage génique médié par siARN in vivo. Nat. Biotechnologie. 36, 509–511 (2018).

Huang, Y. Avancées précliniques et cliniques des thérapies à base d'acides nucléiques décorés de GalNAc. Mol. Là. Acides nucléiques 6, 116–132 (2017).

Lu, X. et al. Régulation efficace des gènes antisens via des brosses non cationiques en polyéthylène glycol. Confiture. Chem. Soc. 138, 9097–9100 (2016).

Jia, F. et al. Profilage en profondeur de la stabilité de la nucléase et de l'efficacité de silençage génique des conjugués poly(éthylène glycol)-ADN à architecture en brosse. Confiture. Chem. Soc. 139, 10605–10608 (2017).

Jin, Y. et al. Nanofleurs d'ADNzyme multifonctionnelles et biodégradables pour une thérapie améliorée contre le cancer. NPG Asie Mater. 9, e365 (2017).

Lee, J.H. et al. Nanoparticules de siARN polymères basées sur la transcription en cercle roulant pour une livraison ciblée sur les tumeurs. J. Contrôle. Sortie 263, 29–38 (2017).

Rozema, D.B. et al. Véhicules d'administration d'ARNsi déclenchés par une protéase. J. Contrôle. Sortie 209, 57–66 (2015).

Lee, K. et al. Livraison in vivo de facteurs de transcription avec des oligonucléotides multifonctionnels. Nat. Mater. 14, 701–706 (2015). Cet article présente une procédure pour la livraison de facteurs de transcription in vivo à l'aide d'oligonucléotides modifiés avec des constructions sensibles au pH.

McCaffrey, J., Donnelly, R. F. & McCarthy, H. O. Microneedles : une plate-forme innovante pour la livraison de gènes. Médicament Livr. Transl Res. 5, 424–437 (2015).

Suda, T. & Liu, D. Livraison de gènes hydrodynamiques: ses principes et applications. Mol. Là. 15, 2063–2069 (2007).

Stewart, M.P. et al. Stratégies in vitro et ex vivo pour l'administration intracellulaire. La nature 538, 183–192 (2016).

Jackson, H. J., Rafiq, S. & Brentjens, R. J. Conduire les cellules CAR T vers l'avant. Nat. Rév. Clin. Oncol. 13, 370–383 (2016).

Ding, X. et al. Livraison nucléaire à haut débit et expression rapide de l'ADN via une perturbation mécanique et électrique de la membrane cellulaire. Nat. Biomed. Ing. 1, 0039 (2017).

Chiappini, C. et al. Des nanoaiguilles de silicium biodégradables délivrant des acides nucléiques de manière intracellulaire induisent une néovascularisation localisée in vivo. Nat. Mater. 14, 532–539 (2015).

Anderson, C. D., Moisyadi, S., Avelar, A., Walton, C. B. & Shohet, R. V. Livraison hépatique ciblée par ultrasons de facteur IX chez des souris hémophiles. Gene Ther. 23, 510–519 (2016).

Manta, S. et al. Microbulles cationiques et miniplasmide sans antibiotique pour une expression transgénique soutenue par ultrasons dans le foie. J. Contrôle. Sortie 262, 170–181 (2017).

Chertok, B., Langer, R. S. & amp Anderson, D. G. Contrôle spatial de l'expression des gènes par des nanocarriers en utilisant le masquage à l'héparine et la destruction de microbulles ciblée par ultrasons. ACS Nano 10, 7267–7278 (2016).

Yoon, S., Wang, P., Peng, Q., Wang, Y. & Shung, K. K. Transfection acoustique pour la manipulation génomique de cellules individuelles à l'aide d'ultrasons à haute fréquence. Sci. représentant 7, 5275 (2017).

Pastuzyn, E.D. et al. Le gène neuronal Arc code pour une protéine Gag de rétrotransposon réutilisée qui médie le transfert d'ARN intercellulaire. Cellule 172, 275 (2018).

Chen, L.S. et al. Transfert de gènes efficace à l'aide de la particule humaine semblable au virus JC qui inhibe la croissance de l'adénocarcinome du côlon humain dans un modèle de souris nude. Gene Ther. 17, 1033–1041 (2010).

Lee, P.W. et al. La structure et la conformation des polymères modifient l'antigénicité des conjugués particules-polymères de type virus. Confiture. Chem. Soc. 139, 3312–3315 (2017).

Zackova Suchanova, J., Neburkova, J., Spanielova, H., Forstova, J. & Cigler, P. Reciblage des particules de type polyomavirus vers les cellules cancéreuses par modification chimique de la surface de la capside. Bioconjug. Chem. 28, 307–313 (2017).

Tong, G.J., Hsiao, S.C., Carrico, Z.M. & Francis, M.B. Conjugués d'aptamère d'ADN de capside virale en tant que véhicules de ciblage cellulaire multivalents. Confiture. Chem. Soc. 131, 11174–11178 (2009).

Eguchi, A. et al. Livraison efficace d'ARNsi dans les cellules primaires par la protéine de fusion domaine de transduction peptidique-domaine de liaison ARNdb (PTD-DRBD). Nat. Biotechnologie. 27, 567–571 (2009).

Yang, N.J. et al. Livraison cytosolique d'ARNsi par des protéines de liaison d'ARNdb à ultra-haute affinité. Acides nucléiques Res. 45, 7602–7614 (2017).

Bienk, K. et al. Une stratégie basée sur la conception du cholestérol médié par l'albumine pour le réglage de la pharmacocinétique des siARN et du silençage génique. J. Contrôle. Sortie 232, 143–151 (2016).

Sarett, S.M. et al. L'ARNsi lipophile cible l'albumine in situ et favorise la biodisponibilité, la pénétration tumorale et l'extinction des gènes sans porteur. Proc. Natl Acad. Sci. Etats-Unis 114, E6490–E6497 (2017).

Hvam, M.L. et al. Constructions d'oligonucléotides antisens et d'albumine sérique modifiés par des acides gras pour la modulation pharmacocinétique. Mol. Là. 25, 1710–1717 (2017).

Song, E. et al. L'anticorps médié par la délivrance in vivo de petits ARN interférents via des récepteurs de surface cellulaire. Nat. Biotechnologie. 23, 709–717 (2005).

Cuellar, T.L. et al. Évaluation systématique de la délivrance de siRNA médiée par des anticorps à l'aide d'une plate-forme industrielle de conjugués THIOMAB-siRNA. Acides nucléiques Res. 43, 1189–1203 (2015).

Lehto, T., Ezzat, K., Wood, M.J.A. & amp El Andaloussi, S. Peptides for nucleic acid delivery. Av. Médicament Livr. Tour. 106, 172–182 (2016).

Tai, W. & Gao, X. Peptides fonctionnels pour la livraison d'ARNsi. Av. Médicament Livr. Tour. 110–111, 157–168 (2017).

Hammond, S.M. et al. La thérapie systémique par oligonucléotides à médiation peptidique améliore la survie à long terme dans l'amyotrophie spinale. Proc. Natl Acad. Sci. Etats-Unis 113, 10962–10967 (2016).

Echigoya, Y. et al. Effets du saut de multiexon systémique avec des morpholinos conjugués à des peptides dans le cœur d'un modèle canin de dystrophie musculaire de Duchenne. Proc. Natl Acad. Sci. Etats-Unis 114, 4213–4218 (2017).

Medina, S.H. et al. Un peptide intrinsèquement désordonné facilite l'entrée des cellules non endosomales. Angew. Chem. Int. Éd. 55, 3369–3372 (2016).

Soudah, T., Mogilevsky, M., Karni, R. & Yavin, E. Conjugués CLIP6-PNA-peptide: livraison non endosomale d'oligonucléotides de commutation d'épissage. Bioconjug. Chem. 28, 3036–3042 (2017).

Bulut, S. et al. Libération et administration lentes d'un médicament oligonucléotidique antisens par des nanofibres amphiphiles peptidiques auto-assemblées. Biomacromolécules 12, 3007–3014 (2011).

Mazza, M., Hadjidemetriou, M., de Lázaro, I., Bussy, C. & Kostarelos, K. Complexes de nanofibres peptidiques avec siRNA pour le silençage des gènes du cerveau profond par neurochirurgie stéréotaxique. ACS Nano 9, 1137–1149 (2015).

Yolamanova, M. et al. Les nanofibrilles peptidiques stimulent le transfert de gènes rétroviraux et fournissent un moyen rapide de concentrer les virus. Nat. Nanotechnologie. 8, 130–136 (2013).

Dai, B. et al. Assemblage réglable de peptides formant de l'amyloïde dans des nanofeuillets en tant que transporteur de rétrovirus. Proc. Natl Acad. Sci. Etats-Unis 112, 2996–3001 (2015).

McCarthy, H.O. et al. Développement et caractérisation de nanoparticules auto-assemblantes à l'aide d'un peptide amphipathique bio-inspiré pour la délivrance de gènes. J. Contrôle. Sortie 189, 141–149 (2014).

Udhayakumar, V.K. et al. Les nanocomplexes d'ARNm à base de peptides riches en arginine stimulent efficacement l'immunité des cellules T cytotoxiques en fonction de l'organisation amphipathique du peptide. Av. Santéc. Mater. 6, 1601412 (2017).

Douat, C. et al. Un foldamère pénétrant dans les cellules avec une liaison bioréductible pour l'administration intracellulaire d'ADN. Angew. Chem. Int. Éd. 54, 11133–11137 (2015).

Gehin, C. et al. Bibliothèques d'amphiphiles dynamiques pour cribler la livraison «parfumée» de siRNA dans les cellules HeLa et les fibroblastes primaires humains. Confiture. Chem. Soc. 135, 9295–9298 (2013).

Louzao, I., García-Fandiño, R. & Monténégro, J. Peptides modulés par Hydrazone pour une transfection génique efficace. J. Mater. Chem. B 5, 4426–4434 (2017).

Lostalé-Seijo, I., Louzao, I., Juanes, M. & Monténégro, J. Peptide/Cas9 nanostructures pour le transport de la membrane cellulaire des ribonucléoprotéines et l'édition de gènes. Chem. Sci. 8, 7923–7931 (2017).

Li, M. et al. L'incorporation d'un analogue d'arginine non naturel dans un peptide cyclique conduit à la formation de nanofibres chargées positivement capables de transfection génique. Angew. Chem. Int. Éd. 55, 598–601 (2016).

Li, M., Schlesiger, S., Knauer, S. K. & amp Schmuck, C. Un motif de liaison d'anions spécifique sur mesure dans la chaîne latérale transforme un tétrapeptide en un vecteur efficace pour la délivrance de gènes. Angew. Chem. Int. Éd. 54, 2941–2944 (2015). Cet article présente le nouveau groupe guanidiniocarbonyl pyrrole pour l'administration d'acide nucléique.

Monténégro, J., Ghadiri, M. R. & Granja, J. R. Modèles de canaux ioniques basés sur des nanotubes peptidiques cycliques auto-assemblés. Acc. Chem. Rés. 46, 2955–2965 (2013).

Jana, P. et al. Transfection génique efficace grâce à l'inhibition de la formation de feuillets β (fibre amyloïde) d'un peptide amphiphile court par des nanoparticules d'or. Angew. Chem. Int. Éd. 56, 8083–8088 (2017).

Freire, J.M. et al. complexes siRNA-peptides pénétrant dans les cellules comme thérapie combinatoire contre la leucémie myéloïde chronique en utilisant la lignée cellulaire BV173 comme modèle. J. Contrôle. Sortie 245, 127–136 (2017).

Felgner, P.L. et al. Lipofection : une procédure de transfection d'ADN à médiation lipidique hautement efficace. Proc. Natl Acad. Sci. Etats-Unis 84, 7413–7417 (1987).

Allen, T. M. & Cullis, P. R. Systèmes d'administration de médicaments liposomaux : du concept aux applications cliniques. Av. Médicament Livr. Tour. 65, 36–48 (2013).

Oude Blenke, E. E., van den Dikkenberg, J., van Kolck, B., Kros, A. & Mastrobattista, E. Coiled coil interactions pour le ciblage des liposomes pour l'administration d'acides nucléiques. Nanoéchelle 8, 8955–8965 (2016).

Yang, J. et al. Administration de médicaments par fusion de membranes cellulaires à l'aide de liposomes modifiés par des lipopeptides. ACS Cent. Sci. 2, 621–630 (2016).

O'Brien, P. J., Elahipanah, S., Rogozhnikov, D. & Yousaf, M. N. Transfection d'acides nucléiques à médiation bio-orthogonale des cellules via l'ingénierie de la surface cellulaire. ACS Cent. Sci. 3, 489–500 (2017). Cette étude décrit une méthode pour l'application de la chimie bioorthogonale à la fusion de liposomes.

Kauffman, K.J. et al. Optimisation des formulations de nanoparticules lipidiques pour la livraison d'ARNm in vivo avec des conceptions de criblage factoriel fractionnel et définitif. Nano Lett. 15, 7300–7306 (2015).

Farhood, H., Serbina, N. & Huang, L. Le rôle de la dioléoyl phosphatidyléthanolamine dans le transfert de gènes à médiation par les liposomes cationiques. Biochim. Biophys. Acta 1235, 289–295 (1995).

Leal, C., Bouxsein, N. F., Ewert, K. K. & Safinya, C. R. Activité de silençage génique hautement efficace de l'ARNsi intégré dans une matrice lipidique cubique gyroïde nanostructurée. Confiture. Chem. Soc. 132, 16841–16847 (2010).

Kim, H. & Leal, C. Cuboplexes : livraison de siARN topologiquement active. ACS Nano 9, 10214–10226 (2015).

Evers, M.J.W. et al.Conception de pointe et techniques de production de mélange rapide de nanoparticules lipidiques pour la délivrance d'acides nucléiques. Petites méthodes. https://doi.org/10.1002/smtd.201700375 (2018).

Whitehead, K.A. et al. Nanoparticules lipidiques dégradables avec une activité de livraison d'ARNsi in vivo prévisible. Nat. Commun. 5, 4277 (2014).

Viricel, W. et al. Lipides commutables cationiques : commutateur moléculaire déclenché par le pH pour l'administration d'ARNsi. Nanoéchelle 9, 31–36 (2017).

Kranz, L.M. et al. L'administration systémique d'ARN aux cellules dendritiques exploite la défense antivirale pour l'immunothérapie anticancéreuse. La nature 534, 396–401 (2016).

Oberli, M.A. et al. Livraison d'ARNm assistée par nanoparticules lipidiques pour une puissante immunothérapie contre le cancer. Nano Lett. 17, 1326–1335 (2017).

Liang, C. et al. Nanoparticules lipidiques fonctionnalisées par aptamère ciblant les ostéoblastes en tant que nouvelle stratégie anabolique osseuse basée sur l'interférence ARN. Nat. Méd. 21, 288–294 (2015).

Ripoll, M. et al. Les micelles polydiacétyléniques nanométriques sensibles au pH permettent une livraison efficace de l'ARNsi intracellulaire. ACS Appl. Mater. Interfaces 8, 30665–30670 (2016).

Morin, E., Nothisen, M., Wagner, A. & Remy, J.S. Micelles de polydiacétylène cationiques pour la délivrance de gènes. Bioconjug. Chem. 22, 1916–1923 (2011).

Neuberg, P. et al. Nanofibres polydiacétyléniques en tant que nouveaux véhicules siRNA pour la livraison in vitro et in vivo. Nanoéchelle 10, 1587–1590 (2018).

Jayaraman, M. et al. Maximiser la puissance des nanoparticules lipidiques d'ARNsi pour le silençage des gènes hépatiques in vivo. Angew. Chem. Int. Éd. 51, 8529–8533 (2012).

Yim, N. et al. Ingénierie des exosomes pour une administration intracellulaire efficace de protéines solubles à l'aide d'un module d'interaction protéine-protéine optiquement réversible. Nat. Commun. 7, 12277 (2016).

Lee, J. et al. Ingénierie cellulaire avec des liposomes membranaires fusogènes pour produire des vésicules extracellulaires fonctionnalisées. ACS Appl. Mater. Interfaces 8, 6790–6795 (2016). Cette étude décrit une méthode polyvalente pour la fonctionnalisation chimique des exosomes.

O'Loughlin, A.J. et al. Livraison fonctionnelle d'ARNsi conjugués aux lipides par des vésicules extracellulaires. Mol. Là. 25, 1580–1587 (2017).

Didiot, M.C. et al. Livraison médiée par les exosomes d'ARNsi modifié de manière hydrophobe pour l'extinction de l'ARNm de la Huntingtine. Mol. Là. 24, 1836–1847 (2016).

Cui, Z.K. et al. Livraison de siRNA via des stérosomes cationiques pour améliorer la différenciation ostéogénique des cellules souches mésenchymateuses. J. Contrôle. Sortie 217, 42–52 (2015).

Wang, Y. et al. Une stratégie basée sur les nanoparticules pour l'imagerie d'un large éventail de tumeurs par amplification non linéaire des signaux du microenvironnement. Nat. Mater. 13, 204–212 (2014).

Xu, X. et al. Nanoplate-forme ultra-sensible au pH et pénétrant les tumeurs pour une livraison ciblée d'ARNsi avec une efficacité anticancéreuse robuste. Angew. Chem. Int. Éd. 55, 7091–7094 (2016).

Xu, X. et al. Plate-forme multifonctionnelle de nanoparticules d'administration de siARN de type enveloppe pour le traitement du cancer de la prostate. ACS Nano 11, 2618–2627 (2017).

Zhou, J. et al. Nanomicelles sensibles au pH pour une délivrance d'ARNsi à haute efficacité in vitro et in vivo : un aperçu de la conception de polycations avec une libération cytosolique robuste. Nano Lett. 16, 6916–6923 (2016). Cet article se concentre sur les propriétés des polycations nécessaires pour maximiser la libération cytosolique des cargaisons d'ARNsi dans des conditions de très faible absorption..

Chiper, M., Tounsi, N., Kole, R., Kichler, A. & amp Zuber, G. Les polyéthylèneimines auto-agrégées de 1,8 kDa avec commutateur de dissolution à pH acide endosomal sont des vecteurs de livraison pour l'ADN plasmidique, l'ARNm, l'ARNsi et l'exon- sauter des oligonucléotides. J. Contrôle. Sortie 246, 60–70 (2017).

Cheng, Y., Yumul, R.C. & Pun, S.H. Polymère inspiré du virus pour une délivrance efficace de gènes in vitro et in vivo. Angew. Chem. Int. Éd. 55, 12013–12017 (2016).

Cheng, Y. et al. Développement de polymères commutables pour résoudre le dilemme de la stabilité et de la libération de la cargaison dans les transporteurs d'acides nucléiques polycationiques. Biomatériaux 127, 89–96 (2017).

McKinlay, C.J. et al. Transporteurs libérables modifiant la charge (CART) pour la livraison et la libération d'ARNm chez les animaux vivants. Proc. Natl Acad. Sci. Etats-Unis 114, E448–E456 (2017). Cette étude décrit un polymère auto-immolable qui peut délivrer de l'ARNm dans les cellules primaires et in vivo.

Chahal, J.S. et al. Les nanoparticules de dendrimère-ARN génèrent une immunité protectrice contre les défis mortels Ebola, H1N1 et Toxoplasma gondii avec une seule dose. Proc. Natl Acad. Sci. Etats-Unis 113, E4133–E4142 (2016).

Liu, S. et al. Polyéthylèneimine coordinatrice de zinc(ii) bioréductible à faible poids moléculaire pour une livraison robuste de gènes de cellules primaires et souches. Confiture. Chem. Soc. 139, 5102–5109 (2017).

Zou, Y. et al. Les polymersomes chimériques imitant les virus stimulent la thérapie ciblée des siARN du cancer in vivo. Av. Mater. 29, 1703285 (2017).

Li, L. et al. Le virus artificiel fournit le système CRISPR-Cas9 pour l'édition du génome des cellules chez la souris. ACS Nano 11, 95–111 (2017).

Naito, M. et al. Une micelle complexe polyionique fonctionnalisée par phénylboronate pour la libération de siARN déclenchée par l'ATP. Angew. Chem. Int. Éd. 51, 10751–10755 (2012).

Naito, M. et al. Livraison intracellulaire améliorée de siRNA en contrôlant la sensibilité à l'ATP des micelles du complexe polyion fonctionnalisé par l'acide phénylboronique. Macromole. Biosci. 18, 1700357 (2018).

Yoshinaga, N. et al. Des micelles polyplexes avec une réticulation phénylboronate/gluconamide dans le noyau exerçant une transfection génique favorisée par une réactivité spatio-temporelle au pH intracellulaire et à la concentration d'ATP. Confiture. Chem. Soc. 139, 18567–18575 (2017).

Truong, N.P. et al. Un système polymère inspiré du virus de la grippe pour la libération programmée d'ARNsi. Nat. Commun. 4, 1902 (2013).

Wang, M., Liu, H., Li, L. & Cheng, Y. Un dendrimère fluoré atteint une excellente efficacité de transfection génique à des rapports azote/phosphore extrêmement faibles. Nat. Commun. 5, 3053 (2014).

Wang, H. et al. Les fluorodendrimères auto-assemblés combinent les caractéristiques des vecteurs lipidiques et polymériques dans la livraison de gènes. Angew. Chem. Int. Éd. 54, 11647–11651 (2015).

Wang, L. H., Wu, D. C., Xu, H. X. & You, Y. Z. Haute affinité de liaison à l'ADN et efficacité de transfection génique des nanomicelles cationiques bioréductibles avec un noyau fluoré. Angew. Chem. Int. Éd. 55, 755–759 (2016).

Zhang, Z. et al. L'effet de fluoration des fluoroamphiphiles dans la livraison de protéines cytosoliques. Nat. Commun. 9, 1377 (2018).

Davis, M. E. La première livraison ciblée de siARN chez l'homme via une nanoparticule : du concept à la clinique. Mol. Pharmacie. 6, 659–668 (2009).

Maity, S., Choudhary, P., Manjunath, M., Kulkarni, A. & Murthy, N. Un polymère d'adamantane biodégradable avec des liaisons cétal dans son épine dorsale pour la thérapie génique. Chem. Commun. 51, 15956–15959 (2015).

Chen, X., Qiu, Y. K., Owh, C., Loh, X. J. & Wu, Y. L. Nanocarriers supramoléculaires de cyclodextrine pour la chimiothérapie et la thérapie génique vers le traitement efficace des cancers résistants aux médicaments. Nanoéchelle 8, 18876–18881 (2016).

Eldredge, A. C., Johnson, M. E., Oldenhuis, N. J. & Guan, Z. Approche de bibliothèque focalisée pour découvrir des bolaamphiphiles dipeptides discrets pour la livraison d'ARNsi. Biomacromolécules 17, 3138–3144 (2016).

Yan, Y. et al. Les polyesters fonctionnels permettent l'administration sélective d'ARNsi au cancer du poumon par rapport aux cellules normales correspondantes. Proc. Natl Acad. Sci. Etats-Unis 113, E5702–E5710 (2016).

Hao, J. et al. Synthèse rapide d'une bibliothèque de polyesters lipocationiques via la polymérisation par ouverture de cycle de valérolactones fonctionnelles pour une livraison efficace de siRNA. Confiture. Chem. Soc. 137, 9206–9209 (2015).

Priegue, J.M. et al. Polymères fonctionnalisés in situ pour la livraison de siRNA. Angew. Chem. Int. Éd. 55, 7492–7495 (2016).

Priegue, J.M. et al. Polymères activés par l'hydrazone de différentes longueurs pour la condensation d'ADN plasmidique et la transfection cellulaire. Biomacromolécules 19, 2638–2649 (2018).

Zhao, Y. et al. PolyMetformin combine des activités porteuses et anticancéreuses pour la livraison de siARN in vivo. Nat. Commun. 7, 11822 (2016).

Lyu, Y. et al. Polymère semi-conducteur dendronisé comme nanosupport photothermique pour l'activation à distance de l'expression génique. Angew. Chem. Int. Éd. 56, 9155–9159 (2017).

Tan, Z., Dhande, Y. K. & Reineke, T. M. Les polymères pénétrant dans les cellules contenant du guanidinium déclenchent l'apoptose dans les cellules de carcinome hépatocellulaire humain, à moins qu'ils ne soient conjugués à un bloc de ciblage N-acétyl-galactosamine. Bioconjug. Chem. 28, 2985–2997 (2017).

Liu, Y., Wenning, L., Lynch, M. & amp Reineke, T. M. Les nouvelles poly(D-glucaramidoamine) induisent la formation de nanoparticules d'ADN et l'administration efficace de gènes dans les cellules de mammifères. Confiture. Chem. Soc. 126, 7422–7423 (2004).

Dong, Y. et al. Les brosses en poly(glycoamidoamine) ont formulé des nanomatériaux pour l'administration systémique d'ARNsi et d'ARNm in vivo. Nano Lett. 16, 842–848 (2016).

Kaczmarek, J.C. et al. Nanoparticules polymères-lipides pour l'administration systémique d'ARNm aux poumons. Angew. Chem. Int. Éd. 55, 13808–13812 (2016).

Li, J. et al. Assemblage structurellement programmé du nanoplex d'initiation de la traduction pour une livraison supérieure d'ARNm. ACS Nano 11, 2531–2544 (2017).

Hong, C.A. et al. SiARN dendrimère pour un silençage génique efficace. Angew. Chem. Int. Éd. 54, 6740–6744 (2015).

Smith, T.T. et al. Programmation in situ de cellules T spécifiques de la leucémie à l'aide de nanocarriers d'ADN synthétiques. Nat. Nanotechnologie. 12, 813–820 (2017). Cette étude décrit une méthode pour la modification in situ des cellules T pour l'immunothérapie du cancer.

Graham, F.L. & van der Eb, A.J. Une nouvelle technique pour le dosage de l'infectivité de l'ADN de l'adénovirus 5 humain. Virologie 52, 456–467 (1973).

Hong, G., Diao, S., Antaris, A. L. & Dai, H. Nanomatériaux de carbone pour l'imagerie biologique et la thérapie nanomédicale. Chem. Tour. 115, 10816–10906 (2015).

Pantarotto, D. et al. Nanotubes de carbone fonctionnalisés pour la délivrance de gènes d'ADN plasmidique. Angew. Chem. Int. Éd. 43, 5242–5246 (2004).

Battigelli, A. et al. Nanotubes de dendron-carbone d'ammonium et de guanidinium par chimie d'amidation et de clic et leur utilisation pour la livraison de siRNA. Petit 9, 3610–3619 (2013).

Kam, N. W., Liu, Z. & Dai, H. Fonctionnalisation de nanotubes de carbone via des liaisons disulfure clivables pour une livraison intracellulaire efficace de siRNA et un puissant silençage génique. Confiture. Chem. Soc. 127, 12492–12493 (2005).

Wang, J.T. et al. La relation entre le diamètre des nanotubes de carbone multiparois chimiquement fonctionnalisés et leurs profils de biodistribution d'organes in vivo. Biomatériaux 35, 9517–9528 (2014).

Cifuentes-Rius, A. et al. Devenir in vivo de nanotubes de carbone avec différentes propriétés physico-chimiques pour des applications de délivrance de gènes. ACS Appl. Mater. Interfaces 9, 11461–11471 (2017).

Munk, M. et al. Livraison efficace d'ADN dans des embryons préimplantatoires bovins par des nanotubes de carbone multiparois. Sci. représentant 6, 33588 (2016).

Maeda-Mamiya, R. et al. Livraison de gènes in vivo par le tétraamino fullerène cationique. Proc. Natl Acad. Sci. Etats-Unis 107, 5339–5344 (2010).

Sigwalt, D. et al. Livraison de gènes avec des adduits polycationiques fullerène hexakis. Chem. Commun. 47, 4640–4642 (2011).

Wang, J. et al. Libération de cytosol visible par commutation de lumière d'ARNsi par un dérivé de fullerène amphiphile pour améliorer l'efficacité de l'ARNi in vitro et in vivo. Acta Biomater. 59, 158–169 (2017).

Dowaidar, M., Abdelhamid, H. N., Hällbrink, M., Zou, X. & Langel, . Nanofeuilles d'oxyde de graphène en complexe avec des peptides pénétrant les cellules pour la livraison d'oligonucléotides. Biochim. Biophys. Acta 1861, 2334–2341 (2017).

Chu, Z. et al. Échappement endosomal rapide des nanodiamants épineux : implications pour la délivrance de gènes. Sci. représentant 5, 11661 (2015).

Lim, D.G. et al. Nanodiamants décorés de polyamidoamine en tant que vecteur de livraison de gènes hybrides et caractérisation structurelle d'ARNsi aux interfaces chargées. ACS Appl. Mater. Interfaces 9, 31543–31556 (2017).

Zhang, X. Q. et al. Plateformes de nanodiamants fonctionnalisés par des polymères en tant que véhicules pour la livraison de gènes. ACS Nano 3, 2609–2616 (2009).

Chen, M. et al. Vecteurs de nanodiamants fonctionnalisés avec de la polyéthylèneimine pour la livraison d'ARNsi. J. Phys. Chem. Lett. 1, 3167–3171 (2010).

Yi, Y. et al. Livraison systémique ciblée de siRNA au modèle de cancer du col de l'utérus à l'aide de nanoparticules d'or assemblées par un complexe polyion unimère cyclique installé par RGD. J. Contrôle. Sortie 244, 247–256 (2016).

Conde, J., Oliva, N., Zhang, Y. & Artzi, N. La trithérapie locale entraîne une régression tumorale et prévient la récidive dans un modèle de cancer du côlon. Nat. Mater. 15, 1128–1138 (2016).

Lei, Y. et al. Livraison assistée par des nanoclusters d'or de siRNA NGF pour un traitement efficace du cancer du pancréas. Nat. Commun. 8, 15130 (2017).

Cutler, J.I., Auyeung, E. & Mirkin, C.A. Acides nucléiques sphériques. Confiture. Chem. Soc. 134, 1376–1391 (2012).

Randeria, P.S. et al. Les acides nucléiques sphériques à base de siRNA inversent la cicatrisation des plaies chez les souris diabétiques par knockdown ganglioside GM3 synthase. Proc. Natl Acad. Sci. Etats-Unis 112, 5573–5578 (2015).

Sita, T.L. et al. Surveillance de la double bioluminescence et de la fluorescence dans le proche infrarouge pour évaluer l'activité des nanoconjugués d'acides nucléiques sphériques in vivo. Proc. Natl Acad. Sci. Etats-Unis 114, 4129–4134 (2017).

Li, N. et al. Livraison d'ARNsi à visée nucléaire pour un silençage génique à long terme. Chem. Sci. 8, 2816–2822 (2017). Cet article montre l'effet que la distribution subcellulaire de la cargaison a sur la durée du silençage génique.

Rouge, J.L. et al. Acides nucléiques ribozymes-sphériques. Confiture. Chem. Soc. 137, 10528–10531 (2015).

Ruan, W. et al. Acides nucléiques sphériques à matrice d'ADN nanoclew pour la livraison d'ARNsi. Chem. Commun. 54, 3609–3612 (2018).

Calabrese, C.M. et al. Conjugués nanoparticule-acide nucléique-polymère à coordination infinie biocompatibles pour la régulation des gènes antisens. Angew. Chem. Int. Éd. 54, 476–480 (2015).

Banga, R.J., Chernyak, N., Narayan, S.P., Nguyen, S.T. & Mirkin, C.A. Acides nucléiques sphériques liposomaux. Confiture. Chem. Soc. 136, 9866–9869 (2014).

Li, H. et al. Acides nucléiques sphériques moléculaires. Proc. Natl Acad. Sci. Etats-Unis 115, 4340–4344 (2018).

Möller, K. et al. Livraison de siRNA très efficace à partir de nanoparticules de silice mésoporeuses core-shell avec des capuchons polymères multifonctionnels. Nanoéchelle 8, 4007–4019 (2016).

Shen, J. et al. Support de silicium nanoporeux haute capacité pour l'administration systémique de thérapies de silençage génique. ACS Nano 7, 9867–9880 (2013).

Kapilov-Buchman, Y., Lellouche, E., Michaeli, S. & Lellouche, J. P. Modification de surface unique de nanoparticules de silice avec de la polyéthylèneimine (PEI) pour la livraison d'ARNsi à l'aide de la chimie de coordination des cations cérium. Bioconjug. Chem. 26, 880–889 (2015).

Shen, J. et al. Encapsulation en plusieurs étapes d'agents de chimiothérapie et de silençage génique dans des nanoparticules de silice mésoporeuses fonctionnalisées. Nanoéchelle 9, 5329–5341 (2017).

He, C., Lu, K., Liu, D. & amp Lin, W. Structures métallo-organiques à l'échelle nanométrique pour la co-administration de cisplatine et d'ARNsi regroupés pour améliorer l'efficacité thérapeutique dans les cellules cancéreuses de l'ovaire résistantes aux médicaments. Confiture. Chem. Soc. 136, 5181–5184 (2014).

Chen, Q. et al. Nanoparticules de charpente métal-organique poreuses décorées de Se/Ru pour l'administration de siARN regroupés pour inverser la multirésistance aux médicaments dans les cellules cancéreuses du sein résistantes au taxol. ACS Appl. Mater. Interfaces 9, 6712–6724 (2017).

Thierry, A.R. et al. Caractérisation de la livraison de gènes médiée par les liposomes : expression, stabilité et pharmacocinétique de l'ADN plasmidique. Gene Ther. 4, 226–237 (1997).

Tsui, N. B., Ng, E. K. & Lo, Y. M. Stabilité de l'ARN endogène et ajouté dans les échantillons de sang, de sérum et de plasma. Clin. Chem. 48, 1647–1653 (2002).

Sahin, U., Karikó, K. & Türeci, . Thérapeutique à base d'ARNm - développement d'une nouvelle classe de médicaments. Nat. Rev. Drug Discov. 13, 759–780 (2014).

Layzer, J.M. et al. Activité in vivo des siARN résistants aux nucléases. ARN 10, 766–771 (2004).


Production de vecteurs viraux adéno-associés dans des empilements cellulaires pour des études précliniques sur de grands modèles animaux

Les vecteurs de virus adéno-associés (AAV) sont parmi les vecteurs de thérapie génique les plus avancés sur le plan clinique, avec trois thérapies géniques AAV approuvées pour l'homme. L'avancement clinique de nouvelles applications pour l'AAV implique la transition de petits modèles animaux, tels que les souris, vers des modèles animaux plus grands, y compris les chiens, les moutons et les primates non humains. L'une des limites de l'administration d'AAV à des animaux plus gros est la nécessité de grandes quantités de virus à titre élevé. Alors que la culture de cellules en suspension est une méthode évolutive pour la production de vecteurs AAV, peu de laboratoires de recherche disposent de l'équipement (par exemple, des bioréacteurs) ou savent comment produire des AAV de cette manière. De plus, les titres d'AAV sont souvent significativement inférieurs lorsqu'ils sont produits dans des cellules HEK 293 en suspension par rapport aux cellules HEK293 adhérentes. Il est décrit ici une méthode de production de grandes quantités d'AAV à titre élevé à l'aide d'empilements de cellules. Un protocole détaillé de titrage de l'AAV ainsi que des méthodes de validation de la pureté du vecteur sont également décrits. Enfin, les résultats représentatifs de l'expression transgénique médiée par l'AAV dans un modèle de mouton sont présentés. Ce protocole optimisé pour la production à grande échelle de vecteurs AAV dans des cellules adhérentes permettra aux laboratoires de biologie moléculaire de faire progresser les tests de leurs nouvelles thérapies AAV dans des modèles animaux plus grands.

Introduction

La thérapie génique utilisant des vecteurs de virus adéno-associés (AAV) a fait d'énormes progrès au cours des trois dernières décennies 1 , 2 . Les améliorations démontrées dans un large éventail de maladies génétiques, y compris la cécité congénitale, l'hémophilie et les maladies du système musculo-squelettique et du système nerveux central, ont placé la thérapie génique AAV au premier plan de la recherche clinique 3 , 4 . En 2012, l'Agence européenne des médicaments (EMA) a approuvé Glybera, un vecteur AAV1 exprimant la lipoprotéine lipase (LPL) pour le traitement du déficit en LPL, ce qui en fait la première autorisation de mise sur le marché d'un traitement de thérapie génique en Europe ou aux États-Unis 5 . Depuis lors, deux thérapies géniques AAV supplémentaires, Luxturna 6 et Zolgensma 7 , ont reçu l'approbation de la FDA, et le marché devrait se développer rapidement au cours des 5 prochaines années avec jusqu'à 10 à 20 thérapies géniques attendues d'ici 2025 8 . Les données cliniques disponibles indiquent que la thérapie génique AAV est une modalité sûre, bien tolérée et efficace, ce qui en fait l'un des vecteurs viraux les plus prometteurs, avec plus de 244 essais cliniques impliquant l'AAV enregistrés auprès de ClinicalTrials.gov. L'intérêt croissant pour les applications cliniques impliquant des vecteurs AAV nécessite des méthodes de production robustes et évolutives pour faciliter l'évaluation des thérapies AAV dans de grands modèles animaux, car il s'agit d'une étape critique dans le pipeline traductionnel 9 .

Pour la production de vecteurs d'AAV, les deux exigences principales sont le génome d'AAV et la capside. Le génome de l'AAV de type sauvage (wt) est un ADN simple brin d'une longueur d'environ 4,7 kb 10 . Le génome wt-AAV comprend des répétitions terminales inversées (ITR) trouvées aux deux extrémités du génome, qui sont importantes pour l'empaquetage, et le représentant et casquette gènes 11 . Les représentant et casquette les gènes, nécessaires à la réplication du génome, à l'assemblage de la capside virale et à l'encapsulation du génome dans la capside virale, sont retirés du génome viral et fournis en trans pour la production de vecteurs AAV12. L'élimination de ces gènes du génome viral laisse place aux transgènes thérapeutiques et à tous les éléments régulateurs nécessaires, y compris le promoteur et le signal polyA. Les ITR restent dans le génome du vecteur pour assurer une bonne réplication du génome et l'encapsulation virale 13,14. Pour améliorer la cinétique d'expression du transgène, les génomes vecteurs d'AAV peuvent être conçus pour être auto-complémentaires, ce qui atténue le besoin de conversion d'ADN simple brin en ADN double brin pendant la réplication du génome d'AAV, mais réduit la capacité de codage à

Au-delà de la conception du génome de l'AAV, la sélection du sérotype de la capside détermine le tropisme tissulaire et cellulaire du vecteur AAV in vivo 2 . En plus du tropisme tissulaire, il a été démontré que différents sérotypes d'AAV présentent différentes cinétiques d'expression génique 16 . Par exemple, Zincarelli et al. 17  a classé différents sérotypes d'AAV en sérotypes à faible expression (AAV2, 3, 4, 5), sérotypes à expression modérée (AAV1, 6, 8) et sérotypes à expression élevée (AAV7 et 9). Ils ont également classé les sérotypes d'AAV en expression à début lent (AAV2, 3, 4, 5) ou expression à début rapide (AAV1, 6, 7, 8 et 9).Ces tropismes divergents et la cinétique d'expression des gènes sont dus aux variations d'acides aminés dans les protéines de capside, les formations de protéines de capside et les interactions avec les récepteurs/co-récepteurs de la cellule hôte 18 . Certaines capsides d'AAV ont des caractéristiques bénéfiques supplémentaires telles que la capacité de traverser la barrière hémato-encéphalique après administration intravasculaire (AAV9) ou de résider dans des cellules musculaires à longue durée de vie pour une expression transgénique durable (AAV6, 6.2FF, 8 et 9) 19, 20 .

Cet article vise à détailler une méthode rentable pour produire des vecteurs AAV de haute pureté, à titre élevé et de qualité recherche pour une utilisation dans des modèles précliniques de grands animaux. La production d'AAV à l'aide de ce protocole est réalisée en utilisant une transfection à double plasmide dans des cellules de rein embryonnaire humain (HEK) 293 adhérentes cultivées dans des piles de cellules. En outre, l'étude décrit un protocole de purification par chromatographie d'affinité sur sulfate d'héparine, qui peut être utilisé pour les sérotypes d'AAV contenant des domaines de liaison à l'héparine, notamment AAV2, 3, 6, 6.2FF, 13 et DJ 21, 22.

Un certain nombre de systèmes d'encapsidation sont disponibles pour la production de vecteurs AAV. Parmi ceux-ci, l'utilisation d'un système de co-transfection à deux plasmides, dans lequel le Représentant et Casquette et les gènes auxiliaires Ad (E1A, E1B55K, E2A, E4orf6 et VA RNA) sont contenus dans un plasmide (pHelper), présente certains avantages pratiques par rapport à la méthode de transfection commune à trois plasmides (triple), y compris un coût réduit pour la production de plasmides 23 , 24 . Le plasmide du génome de l'AAV contenant la cassette d'expression du transgène (pTransgene), doit être flanqué d'ITR et ne doit pas dépasser

4,7 ko de longueur. Le titre et la pureté du vecteur peuvent être affectés par le transgène en raison d'effets cytotoxiques potentiels pendant la transfection. L'évaluation de la pureté du vecteur est décrite ici. Les vecteurs produits à l'aide de cette méthode, qui donnent un 1 x 10 13 vg/mL pour chacun, ont été évalués chez des souris, des hamsters et des modèles animaux ovins.

Tableau 1 : Composition des solutions requises. Informations nécessaires, y compris les pourcentages et les volumes, des composants nécessaires pour diverses solutions tout au long du protocole. Veuillez cliquer ici pour télécharger ce tableau.

Abonnement requis. Veuillez recommander JoVE à votre bibliothécaire.

Protocole

1. Double transfection plasmidique de cellules HEK293 dans des piles de cellules

  1. Décongeler une cryo-ampoule de cellules HEK293 dans un bain de billes réglé à 37 °C.
    REMARQUE : Préchauffez le DMEM complet à 37 °C pendant la décongélation des cellules pour vous assurer que la température froide ne choque pas les cellules lors du placage. Assurez-vous que les cellules ont un faible nombre de passages, idéalement inférieur à 20, pour assurer une croissance et une efficacité de transfection optimales. Assurez-vous que les cellules sont certifiées exemptes de mycoplasmes.
  2. Transférer goutte à goutte le contenu du flacon cryogénique dans un tube conique de 15 ml contenant 10 ml de DMEM complet préchauffé et centrifuger les cellules à 500 x g pendant 5 minutes.
  3. Aspirer le support, puis remettre en suspension les cellules HEK293 dans 20 ml de DMEM complet préchauffé. Ensemencer les cellules dans une plaque de 15 cm et incuber à 37°C, avec 5% de CO2.
  4. Divisez les cellules d'une plaque de 15 cm en trois pour l'ensemencement dans la chambre de culture cellulaire.
    1. Une fois que les cellules sont à 80% confluentes, aspirez le support et lavez doucement la plaque avec 3 ml de PBS pour ne pas perturber la monocouche. Ensuite, aspirez du PBS et ajoutez 3 ml de trypsine.
    2. Incuber pendant 2 min à 37 °C jusqu'à ce que les cellules se soulèvent de la plaque, puis neutraliser la trypsine en ajoutant 7 ml de DMEM complet à la plaque.
    3. Recueillir tous les médias et les cellules dans un tube de 15 ml et sédimenter les cellules par centrifugation à 500 x g pendant 5 minutes.
    4. Aspirer le surnageant du tube de 15 ml et remettre en suspension le culot cellulaire dans 3 ml de DMEM complet. Ajouter 1 ml à chaque plaque de 15 cm contenant 20 ml de DMEM complet secouer doucement les plaques pour répartir les cellules uniformément, et incuber à 37 °C, avec 5% de CO2.

    Incubation de 65 h, vérifier la confluence de la plaque de référence, idéalement


    Figure 1: Manœuvre de pile cellulaire pour l'ensemencement cellulaire et la transfection. Pour ensemencer la pile de cellules, commencez par retirer l'un des capuchons d'aération et versez 1 L de DMEM complet préchauffé avec la quantité nécessaire de cellules HEK293 (UNE). Répartissez uniformément les cellules et les supports en serrant les deux capuchons d'aération et amenez tous les supports dans le coin de la pile de cellules avec l'un des capuchons d'aération et placez-le dans ce coin (B), placez la pile de cellules sur le côté (C), puis tournez la pile de cellules 90° () de sorte que les orifices de ventilation soient vers le haut (E). Abaissez doucement la pile de cellules à sa position horizontale normale et assurez-vous que toutes les chambres de la pile de cellules sont complètement recouvertes de support (F). Lors de la transfection, dévissez les deux bouchons d'aération et versez lentement les vieux médias dans un conteneur de déchets stériles pour un débit uniforme afin de ne pas perturber la monocouche des cellules (g). Veuillez cliquer ici pour voir une version plus grande de cette figure.

    1. Préparer le mélange polyéthylèneimine (PEI)/ADN à un rapport de concentration de 3:1 (w/w).
      1. Préparer le mélange d'ADN dans un tube conique de 50 ml en ajoutant 475 µg de pTrangene et 1425 µg de pHelper à 40 ml de milieu à sérum réduit pour créer un rapport de 3:1 de pHelper:pTrangene.
        REMARQUE : Le calculateur de mélange PEI/ADN peut être trouvé en utilisant Tableau 2.
      2. Ajouter 5,7 ml de PEI (1 g/L) au milieu à sérum réduit et au mélange d'ADN goutte à goutte. Ensuite, vortexer brièvement et incuber pendant 10 min à température ambiante.
        REMARQUE : Au fur et à mesure que le PEI/ADN incube à température ambiante, il deviendra légèrement trouble.

      2 Récolte d'AAV et lyse chimique des cellules HEK293 transfectées

      1. Agiter vigoureusement la chambre de culture cellulaire pour déloger les cellules jusqu'à ce que le support apparaisse trouble des cellules délogées et verser dans quatre tubes à centrifuger de 500 ml.
      2. Centrifuger les tubes à 18 000 x g pendant 30 min à 4 °C pour sédimenter les cellules. Verser le surnageant clarifié dans une bouteille de 1 L de polyéthylène téréphtalate copolyester (PETG).
        REMARQUE : Si l'on n'a pas accès à une centrifugeuse à grande vitesse, centrifuger à 12 000 x g pendant 40 minutes. Les cellules culottées peuvent ne pas être solides à cette vitesse et glisseront en versant le surnageant.
      3. Remettre en suspension les culots cellulaires dans des tubes à centrifuger de 500 ml avec 50 ml de tampon de lyse et incuber pendant 60 min à 37 °C.
      4. Centrifuger les tubes à 18 000 x g pendant 30 min, puis transférer le surnageant dans la même bouteille PETG de 1 L. Jeter les débris cellulaires agglomérés.
        ​REMARQUE : Purifiez immédiatement le surnageant clarifié et conservez-le à 4 °C jusqu'à 72 h. Pour un stockage à plus long terme, stockez à -80 °C. Ne pas stocker à -20 °C.

      3 Purification du vecteur AAV par chromatographie d'affinité sur héparine

      1. Retirer le lysat brut de -80 °C et laisser à 4 °C pendant la nuit pour décongeler. Une fois décongelé, utilisez un filtre 0,22 µM pour filtrer le lysat brut.
      2. Pour passiver le concentrateur centrifuge, ajouter 4 ml de tampon de prétraitement du filtre à un concentrateur centrifuge pour chaque colonne d'héparine sépharose utilisée. Passivation du concentrateur centrifuge à température ambiante pendant 2 à 8 h. Mettre en place la passivation juste avant les étapes de purification.
      3. Mettre en place la tubulure et la pompe (Figure 2).
        1. Placer le tube dans une pompe péristaltique et exécuter 20 ml de NaOH 1 M. Ensuite, exécutez 50 ml d'eau de qualité moléculaire, puis exécutez 50 ml de DMEM basal.
        2. Fixez 5 ml de colonne d'héparine sépharose au tube et exécutez 25 ml de DMEM basal pour éliminer le conservateur.


        Figure 2: Configuration pour pompe péristaltique pour la purification d'AAV. Exécutez le tube du lysat brut, à travers la pompe péristaltique et dans la colonne de matrice d'héparine. Veuillez cliquer ici pour voir une version plus grande de cette figure.

        REMARQUE : Assurez-vous de ne pas introduire de bulles ou de laisser la colonne s'assécher, car cela compromettrait la colonne et empêcherait l'élution de l'AAV. Jeter la colonne si elle s'assèche et utiliser une nouvelle colonne pour le reste du lysat brut.

        1. Chargez tout le lysat brut sur la colonne d'héparine et utilisez les solutions suivantes pour laver la colonne.
          1. Laver en utilisant 50 ml de 1x solutions salines équilibrées Hank & 39s (HBSS) sans Mg 2+ et Ca 2+.
          2. Laver à l'aide de 15 mL de 0,5 % de N-Lauroylsarcosine dans HBSS sans Mg 2+ et Ca 2+ .
          3. Laver avec 50 mL de HBSS sans Mg 2+ et Ca 2+ .
          4. Laver avec 50 mL de HBSS avec Mg 2+ et Ca 2+
          5. Laver en utilisant 50 ml de NaCl/HBSS 200 mM avec Mg2+ et Ca 2+.
          6. Éluer 5 x 5 ml (25 ml au total) avec 300 mM de NaCl/HBSS avec Mg 2+ et Ca 2+ et étiqueter les élutions comme E1-E5 (chaque élution est de 5 ml).

          4 Extraction d'ADN génomique d'AAV

          1. Préparer le mélange réactionnel mentionné dans Tableau 3 dans un tube PCR pour le traitement à la DNase.

          Tableau 3 : formule du master mix de traitement à la DNase. Composants recommandés et volumes requis pour le traitement à la DNase des vecteurs viraux AAV lors de l'extraction de l'ADN.

          1. Vortexer le tube PCR pour mélanger et pulser le tube PCR pour faire tourner le contenu.
          2. À l'aide d'un thermocycleur, incuber à 37 °C pendant 20 min suivi de 75 °C pendant 15 min pour inactiver la DNase par la chaleur.
          3. Ajouter 5 µL de protéinase K.
          4. À l'aide d'un thermocycleur, incuber à 50 °C pendant 60 min, puis à 95 °C pendant 30 min pour inactiver à la chaleur la protéinase K.
          5. Utilisez un kit de nettoyage d'ADN pour éliminer les contaminants potentiels.
            REMARQUE : Cette étape a été réalisée à l'aide d'un kit de nettoyage de sang et de tissus disponible dans le commerce (Table des matières).
            1. Ajouter 200 µL de tampon AL (Kit de nettoyage du sang et des tissus, Table des matières) dans le tube PCR contenant le vecteur traité à la DNase/Protéinase K.
            2. Vortexer le tube PCR et incuber à 56 °C pendant 10 min dans un thermocycleur.
            3. Pipeter le liquide du tube PCR dans une colonne de centrifugation stérile dans un tube collecteur.
            4. Ajouter 200 µL d'éthanol à 100 % à la colonne et bien mélanger au vortex.
            5. Centrifuger à 6 000 x g pendant 1 min et jeter l'écoulement.
            6. Ajouter 500 µL de tampon AW1 (Kit de nettoyage du sang et des tissus, Table des matières) à la colonne de rotation.
            7. Centrifuger à 6 000 x g pendant 1 min et jeter l'écoulement.
            8. Ajouter 500 µL de tampon AW2 (Kit de nettoyage du sang et des tissus, Table des matières) à la colonne de rotation.
            9. Centrifugeuse à 15 000 x g pendant 3 min et jeter le flux à travers.
            10. Placer la colonne de centrifugation dans un tube à centrifuger stérile de 1,5 ml et ajouter 200 µL de tampon AE (kit de nettoyage du sang et des tissus, Table des matières) directement sur la membrane de la colonne de centrifugation.
            11. Incuber à température ambiante pendant 1 min.
            12. Centrifuger à 6 000 x gpendant 1 min pour éluer l'ADN.
            13. Stockez l'ADN à -20 °C.

            5 Titrage des génomes des vecteurs AAV par amplification en chaîne par polymérase quantitative et sonde Simian Virus 40 (SV40)

            REMARQUE : Effectuez tous les travaux de qPCR dans une hotte PCR à l'aide d'embouts de pipette filtrés pour éviter la contamination externe de l'ADN. Si le génome de l'AAV ne code pas pour une séquence polyA du SV40, utilisez une sonde contre l'ITR décrite ailleurs 25 . Assurez-vous que l'ADN plasmidique sélectionné comme standard contient la séquence polyA SV40.

            1. Préparation standard de stock
              1. Diluer le standard d'ADN plasmidique stock (plasmide pTransgene contenant la séquence polyA SV40) à une concentration finale de 10 µg/µL et conserver à -20 °C dans des aliquotes de 6 µL.
              2. Déterminez le nombre de copies présentes dans le standard d'ADN plasmidique à l'aide de la calculatrice en ligne suivante 26 .
                REMARQUE : Utilisez un ADN plasmidique utilisé pour la norme produite par un fournisseur commercial pour assurer la qualité et la concentration correcte. Préparez une grande quantité d'étalon (par exemple, 10 ml) pour effectuer des études de transition lors de la transition vers un étalon nouvellement préparé.

              Tableau 4 : master mix qPCR pour le titrage AAV. Composants recommandés et volumes requis pour la qPCR d'ADN extrait de vecteurs viraux AAV.

              Composant Séquence
              Amorce avant 5’-AGCAATAGCATCACAAATTTCACAA-3’
              Apprêt inversé 5’-CCAGACATGATAAGATACATTGATGAGTT-3’
              Sonde /56-FAM/AGCATTTTT/Zen/TTCACTGCATTCTAGTTGTGGTTTGTC/3IABkFQ

              Tableau 5 : séquences d'amorces contre la séquence d'ADN polyA du SV40. Séquences des amorces et de la sonde utilisées pour le titrage qPCR, qui se lient à des zones spécifiques des vecteurs viraux AAV qui contiennent la séquence polyA SV40.

              1. Pipeter le master mix de haut en bas pour mélanger.
              2. Mettre en place la plaque de dilution.
                1. Utilisez une plaque transparente à 96 puits pour préparer les dilutions d'étalon et d'échantillon, ajoutez 45 µL d'eau de qualité moléculaire à chaque puits dans une colonne sur deux en commençant par la colonne 1 (colonnes 1, 3, 5, 7, 9 et 11).
                2. Ajouter 5 µL du standard au godet A1 et pipeter pour mélanger.
                3. Utilisez une nouvelle pointe de pipette filtrée pour créer une dilution au 1/10 du puits A1 à B1.
                4. Continuer une série de dilutions de 10 fois dans la colonne jusqu'à atteindre G1.
                5. Ne pas ajouter à H1, car cela agira comme un contrôle négatif.
                6. Appliquer le premier échantillon (S1) en l'ajoutant dans le godet A3, formant une dilution au 1/10. Pipeter ce mélange et transférer 5 µL dans le godet B3. Jeter l'embout de la pipette après ce transfert.
                7. Avec un embout de pipette neuf, mélanger la solution dans le godet B3 et former une dilution au 1/100. Transférer 5 µL de ce mélange dans le godet C3 et jeter l'embout après le transfert.
                8. Avec un embout de pipette neuf, pipeter de haut en bas la solution dans le godet C3 pour faire une dilution au 1/1000. Jeter la pointe.
                9. Continuez à diluer les échantillons sans ajouter d'échantillons aux colonnes 2, 4, 6, 8, 10 ou 12.
                10. Une fois tous les échantillons dilués, mélangez le contenu dans les puits de la colonne 1, puis transférez 20 µL dans la colonne 2.
                11. Répétez cette opération pour les colonnes 3, 5, 7, 9 et 11 pour créer des réplicats de chaque dilution d'étalon et d'échantillon. Faire référence à figure 3 pour la disposition des plaques.
                  ​REMARQUE : Lorsque vous suivez la configuration de la plaque dans figure 3, les échantillons dilués dans les rangées G et H n'auront que des dilutions au 1/10 et au 1/100.


                figure 3: Disposition de la plaque pour le titrage qPCR AAV. Le bleu indique l'emplacement de la dilution en série du standard. Le vert indique l'emplacement du contrôle négatif. Le violet indique l'emplacement de la dilution des échantillons. Chaque standard, négatif ou échantillon est ajouté en réplicat. Un exemple de concentration de l'étalon a été ajouté pour montrer la série de dilutions de l'étalon, et le placement des dilutions d'échantillons a été ajouté à leurs puits respectifs. Veuillez cliquer ici pour voir une version plus grande de cette figure.

                1. Titrage par qPCR basée sur la détection polyA SV40
                  1. Ajouter 15 µL de master mix qPCR à chaque puits d'une plaque qPCR 96 puits à demi-jupe blanche.
                  2. Transférer 5 µL de chaque échantillon de la plaque à 96 puits transparente à la plaque qPCR à 96 puits semi-jupe blanche.
                  3. Utilisez une pipette multicanaux pour assurer un mélange adéquat du master mix qPCR et de l'échantillon.
                  4. Sceller la plaque avec un film d'étanchéité et centrifuger la plaque qPCR à 1500 x g pendant 30 s.
                  5. Exécutez la réaction qPCR sur un instrument d'amplification et de détection par PCR en temps réel sur plaque, en utilisant les conditions suggérées dans Tableau 6.

                  Tableau 6 : Protocole de thermocycleur pour le titrage qPCR basé sur une sonde d'hydrolyse. Protocole de thermocycleur recommandé pour l'utilisation du titrage qPCR basé sur une sonde des vecteurs AAV purifiés extraits de l'ADN.

                  REMARQUE : Pour la feuille de travail de titrage qPCR AAV, voir Tableau 7.

                  1. Analyse des données pour déterminer le nombre de copies du génome d'AAV.
                    1. Remplissez les cellules de données de la feuille de calcul (Tableau 7A) avec les valeurs de concentration obtenues à partir de l'analyse qPCR pour les dilutions d'étalon et d'échantillon.
                    2. Utiliser les valeurs de concentration de Tableau 7A pour produire une courbe standard (Tableau 7B).
                      REMARQUE : La courbe standard sera affichée sous forme de logarithme népérien (oui = une ln(X) + b) ainsi que l'efficacité R2. Une courbe étalon doit avoir un rendement proche de 100 % et R 2 proche de 1,0 (𕟲.99).
                    3. Complétez l'efficacité de la pente en remplissant ce calculateur en ligne 27 .
                      REMARQUE : Une efficacité comprise entre 90 % et 110 % est acceptable. Si l'efficacité de la qPCR est en dehors de cette plage, réexécutez la qPCR.
                    4. Utiliser les valeurs de concentration de Tableau 7A faire la moyenne des dilutions de chaque échantillon et déterminer l'écart type de chaque échantillon (Tableau 7C).
                      REMARQUE : Exclure les dilutions des échantillons qui sont à plus d'un écart type de la moyenne des dilutions des échantillons.
                    5. En utilisant la concentration moyenne de chaque dilution, multipliez par le facteur de dilution, puis divisez par cinq pour obtenir les génomes vecteurs (vg)/µL de chaque échantillon (Tableau 7C).
                    6. Calculez le vg/mL de chaque échantillon en multipliant la moyenne des concentrations de chaque échantillon par 80 000 (Tableau 7C).
                    7. Faites la moyenne des vg/mL de chaque dilution pour produire le vg/mL final de chaque échantillon (Tableau 7C).
                      ​REMARQUE : L'utilisateur doit diviser la concentration moyenne de chaque dilution par un facteur cinq pour tenir compte des 5 µL chargés dans chaque puits pour l'analyse qPCR afin de produire la concentration en vg/µL. Le facteur de 80 000 représente la transition de la valeur de concentration moyenne de chaque échantillon à vg/mL. Tout d'abord, la moyenne de la valeur de concentration de chaque échantillon doit être multipliée par 2 pour tenir compte des génomes simple brin, car l'ensemble sonde-amorce ne quantifie que l'ADN simple brin à sens positif (ADNsb) et le génome de l'AAV existe. dans un rapport approximatif de 1:1 entre l'ADNsb de sens positif et négatif 25, 28 . La moyenne de la valeur de concentration de chaque échantillon doit être multipliée par 40 pour tenir compte de la dilution de l'échantillon de 5 µL de vecteur purifié (section 4.1) à 200 µL d'ADN extrait (section 4.6.12). Enfin, la moyenne de la valeur de concentration de chaque échantillon doit être multipliée par 1000 pour convertir de vg/µL en vg/mL.

                    6 Évaluation de la qualité et de la pureté du vecteur

                    1. Contrôle qualité - Western Blot
                      1. Préparer un gel SDS PAGE à 12%.
                      2. Effectuer une électrophorèse sur gel de polyacrylamide.
                        REMARQUE : Chargez 6 x 10 10 vg d'échantillons par puits.
                      3. Transférer les protéines sur une membrane de difluorure de polyvinylidène (PVDF).
                      4. Membrane bloquante en PVDF
                        1. Retirez la membrane de l'appareil de transfert et rincez dans 0,1% de PBST pour éliminer l'acrylamide en vrac.
                        2. Placer la membrane dans la solution de blocage pendant au moins 1 h à température ambiante ou toute la nuit à 4 °C.
                          REMARQUE : Le tampon de blocage peut être complété par du sérum de chèvre à 2 %.
                        1. Décanter le tampon de blocage et ajouter l'anticorps primaire, un anticorps monoclonal de souris anti-AAV à une dilution 1:200.
                        2. Incuber une nuit à 4 °C.
                        3. Décanter l'anticorps primaire et laver cinq fois avec 0,1% de PBST pendant 5 min à température ambiante avec agitation.
                        1. Décanter la solution de lavage et ajouter l'anticorps secondaire conjugué HRP, dilué à 1:7500 dans un tampon de blocage, et incuber pendant 1 h à température ambiante avec agitation.
                        2. Décanter l'anticorps secondaire et laver cinq fois avec 0,1% de PBST pendant 5 min à température ambiante avec agitation.
                        3. Effectuer un dernier lavage avec du PBS à température ambiante sous agitation.


                        Figure 4: Western blot montrant les protéines de capside d'AAV. Lane A MW ladder, Lane B AAV6.2FF-hIgG01, Lane C AAV6.2FF-hIgG02, Lane D AAV6.2FF-hIgG03 et Lane E AAV6.2FF-hIgG04. 6 x 10 10 vg de chaque AAV6.2FF-hIgG ont été chargés dans leurs voies respectives. Veuillez cliquer ici pour voir une version plus grande de cette figure.

                        1. Contrôle de pureté - FDS PAGE et Coomassie Stain
                          1. Préparer le gel SDS-PAGE et les échantillons comme décrit à l'étape 6.1.1 et 6.1.2.
                          2. Fixer le gel dans la solution de fixation pendant 1 h ou toute la nuit sous agitation douce. Changer la solution de fixation une fois pendant la première heure.
                          3. Colorer le gel dans la solution de coloration pendant 2-4 h avec une agitation douce.
                          4. Décolorer le gel avec une solution de décoloration. Reconstituer la solution de décoloration plusieurs fois jusqu'à ce que le fond du gel soit complètement décoloré (4-24 h).
                          5. Conservez le gel décoloré dans une solution de stockage.
                          6. Image du gel pour visualiser toutes les protéines colorées par la solution de coloration de Coomassie.


                          Figure 5: Gel coloré au Coomassie. Lane A MW ladder, Lane B AAV6.2FF-hIgG01, Lane C AAV6.2FF-hIgG02, Lane D AAV6.2FF-hIgG03, Lane E AAV6.2FF-hIgG04, Lane F AAV6.2FF-hIgG05 et Lane G AAV6. 2FF-hIgG06. 6 x 10 10 vg de chaque AAV6.2FF-hIgG ont été chargés dans leurs voies respectives. Veuillez cliquer ici pour voir une version plus grande de cette figure.

                          1. Test alternatif de contrôle de pureté - ELISA de détection de protéine de cellule hôte HEK293
                            1. Effectuez la détection de la protéine de la cellule hôte HEK293 via ELISA selon les instructions du fabricant.
                              REMARQUE : Utilisez des dilutions de 5 x 10 -2 et 1 x 10 -3 pour les échantillons de rAAV purifiés. Une fois le TMB ajouté dans le puits, incuber à l'abri de la lumière. La régression linéaire ne peut pas être utilisée pour analyser les résultats.
                            2. Effectuez une analyse point à point, une spline cubique ou une méthode d'ajustement logistique à quatre paramètres pour interpoler les concentrations d'inconnues et multiplier par le facteur de dilution pour déterminer la concentration de l'échantillon d'origine.

                            Abonnement requis. Veuillez recommander JoVE à votre bibliothécaire.

                            Résultats représentatifs

                            La traduction de petits modèles de rongeurs vers des modèles animaux plus grands et l'application clinique éventuelle présente un défi important en raison de la grande quantité d'AAV nécessaire pour transduire des animaux plus gros et obtenir des effets thérapeutiques. Pour comparer l'efficacité de transduction de la capside AAV6.2FF conçue de manière rationnelle, on a précédemment démontré une augmentation de 101 fois de l'efficacité de transduction dans les cellules musculaires murines par rapport à AAV6 3 , des souris, des hamsters et des agneaux ont tous reçu AAV6.2FF exprimant un anticorps monoclonal humain ( hIgG). Le vecteur exprimant AAV6.2FF-hIgG contenait un promoteur CASI 4, un élément régulateur post-transcriptionnel du virus de l'hépatite Woodchuck (WPRE) et une séquence polyA SV40. Des souris BALB/c femelles âgées de six semaines (n = 4) ont reçu par voie intramusculaire (IM) 1 x 10 11 vg d'AAV6.2FF-hIgG dans 40 µL, et du sang a été prélevé aux jours 0, 7, 14, 21 et 28 après l'administration d'AAV pour la surveillance des hIgG. Des hamsters syriens âgés de quatre semaines (deux femelles et deux mâles) ont reçu par IM 1 x 10 12 vg d'AAV6.2FF-hIgG dans 40 µL, et du sang a été prélevé chaque semaine pour surveiller l'expression de l'hIgG. Enfin, des agneaux Dorset mâles âgés de 10 jours (n = 3) ont reçu en IM 1 x 10 13 vg/kg d'AAV6.2FF-hIgG en deux à trois injections de 1 mL dans le croupion. Le prélèvement sanguin hebdomadaire a été complété par des saignements jugulaires et l'hIgG a été surveillée chaque semaine pendant 28 jours. Toutes les expérimentations animales ont été approuvées par l'Institutional Animal Care Committee de l'Université de Guelph.

                            Souris IM ayant reçu 5 x 10 12 vg/kg d'AAV6.2FF-hIgG exprimé entre 171-237 µg/mL de hIgG dans le sérum au jour 28 après l'administration (Figure 6). Les hamsters auxquels on a administré par IM 2 x 10 13 vg/kg d'AAV6.2FF-hIgG ont exprimé des taux beaucoup plus élevés que les souris, avec des taux sériques d'hIgG de 495-650 µg/mL au jour 28 après l'administration. Enfin, les moutons IM administrés 1 x 10 13 vg/kg ont exprimé des taux sériques d'hIgG de 21-46 µg/mL au jour 28 après l'administration. Dans tous les modèles animaux, le vecteur ne semble pas entraver les indices de santé, tels que le poids, prouvant la sécurité et la qualité des vecteurs produits. Il est bien connu que l'expression d'anticorps monoclonaux (mAb) médiée par AAV varie considérablement selon l'espèce et le mAb. À la connaissance des auteurs, il n'existe aucun rapport sur l'expression de l'AAV-mAb chez les espèces ovines, il n'y a donc pas de référence pour les niveaux d'expression attendus. Il est à noter que les moutons de cette étude ont doublé de poids au cours de la période de 28 jours suivant l'injection et que les animaux de Figure 6 ont tous été transduits avec différents AAV-mAb et ne peuvent donc pas être comparés.


                            Figure 6: L'administration intramusculaire d'AAV6.2FF-hIgG conduit à une expression sérique soutenue de hIgG chez la souris, le hamster et le mouton. Des souris BALB/c femelles (n = 4) ont reçu par IM 5 x 10 12 vg/kg d'AAV6.2FF-hIgG, des hamsters syriens (2 mâles, 2 femelles) ont reçu par IM 1 x 10 13 vg/kg d'AAV6. 2FF-hIgG et des agneaux Dorset mâles âgés de 10 jours (n = 3) ont reçu 1 x 10 13 vg/kg par voie IM. Le sérum a été surveillé pour l'expression de hIgG sur une période de 28 jours. Les données sont représentées par l'écart type moyen ±. Veuillez cliquer ici pour voir une version plus grande de cette figure.

                            Transfection de la chambre de culture cellulaire
                            Protocole
                            1. Laisser l'ADN, l'OptiMEM et le PEI se réchauffer à température ambiante avant la transfection
                            2. Entrez le nombre de piles de cellules à transfecter (aucun excès requis)
                            3. Assurez-vous que les concentrations d'ADN sont correctes car cela modifiera les volumes requis
                            Nombre de chambres de culture cellulaire 1
                            Concentration de plasmide transgénique 1 mg/mL
                            Concentration du plasmide pDGM6.2FF 1 mg/mL
                            Quantité Par chambres de culture cellulaire Mastermix de transfection
                            OptiMEM 48.1 ml 48.1 ml
                            Rapport 1:3 pTransgene:pHelper pTransgène 475 µg 475 µL
                            PHhelper 1425 µg 1425 µL
                            4. Ajouter les volumes requis d'OptiMEM et d'ADN plasmidique dans un tube conique de 50 ml
                            5. Retourner 10 fois pour mélanger
                            Rapport PEI:ADN 3:1 Î.-P.-É. maximum 5.7 ml 5.7 ml
                            6. Ajouter la quantité requise de PEI dans le tube de 50 ml contenant l'OptiMEM et l'ADN plasmidique
                            7. Fermez immédiatement le tube de 50 ml et vortexez et retournez 3&82115 fois pour mélanger.
                            8. Réglez une minuterie sur 10 min pour que les complexes PEI incubent
                            9. Déplacer les piles de cellules à transfecter dans le BSC
                            10. Après 10 min, versez le mélange de transfection dans un port orange.
                            11. Mélangez doucement le liquide dans toute la pile de cellules
                            12.  Remettre la pile de cellules transfectées dans l'incubateur en assurant un volume égal sur chaque couche
                            13. Récolter la chambre de culture cellulaire 72 h plus tard

                            Tableau 2 : Calculateur de transfection pour chambre de culture cellulaire. Feuille de travail interactive pour déterminer la concentration correcte de pTransgene, pHelper et PEI pour la transfection de la chambre de culture cellulaire.

                            Tableau 7 : Calculateur de titrage AAV. Feuille de travail interactive pour déterminer la concentration finale des échantillons d'AAV de qPCR, exprimée en vg/mL. Veuillez cliquer ici pour télécharger ce tableau.

                            Abonnement requis. Veuillez recommander JoVE à votre bibliothécaire.

                            Discussion

                            La production de vecteurs d'AAV recombinants (rAAV) décrite dans cet article utilise des matériaux, des réactifs et des équipements communs que l'on trouve dans la majorité des laboratoires et des installations de recherche en biologie moléculaire. Ce papier permet une haute qualité in vitro et in vivo grade rAAV à produire par le lecteur. Surtout, ce protocole de production de rAAV, par rapport aux protocoles plus fastidieux impliquant la purification du chlorure de césium, est efficace et évite le recours à l'ultracentrifugation. Une fois les cellules HEK293 transfectées, l'AAV purifié est prêt à l'emploi dans les 5 jours ouvrables.

                            Au cours du processus de production et de purification de rAAV, de nombreuses étapes peuvent influencer la pureté et le titre final du vecteur. La première étape et la plus critique est la santé des cellules HEK293, qui a un effet direct sur le titre du vecteur. L'utilisation de cellules HEK293 par opposition à d'autres types ou systèmes de cellules, tels que les cellules HEK293T, est avantageuse en ce que les cellules HEK293 ont une plus grande capacité à adhérer au revêtement plastique des plaques et des cellules, créant des réseaux cellulaires robustes pour une croissance cellulaire continue. Il est recommandé de surveiller les cellules pour la contamination par les mycoplasmes et d'éviter de transmettre les cellules HEK293 au-delà

                            40 passages ou une fois que leur temps de doublement semble ralentir car cela entraînera une baisse des rendements en AAV. De plus, la confirmation que les cellules sont confluentes à environ 80 % avant la transfection garantit que les cellules ne sont pas trop clairsemées ou envahies par la végétation. En ce qui concerne les composants de transfection, l'utilisation d'ADN plasmidique de haute qualité (p. Enfin, le réactif de transfection a un impact significatif sur les rendements en rAAV. Ici, le PEI est utilisé comme agent de transfection. Le PEI est un polymère cationique stable qui fournit de l'ADN exogène au noyau des cellules grâce à la production de complexes plasmide-polymère, qui sont ensuite absorbés par les cellules et acheminés vers le noyau par le biais de processus de cellule hôte 29 . Les transfections à base de PEI sont rapides et faciles par rapport à d'autres méthodes d'administration d'ADN, notamment le phosphate de calcium ou la lipofectamine. Cependant, le rapport PEI:ADN doit être optimisé.

                            L'utilisation d'empilements de cellules par opposition aux plaques adhérentes traditionnelles fournit une méthode plus pratique et cohérente pour la production de rAAV. Les empilements de cellules impliquent moins de manipulations techniques pendant la transfection, atténuant le délogement possible des cellules de la monocouche adhérente, permettant des réseaux cellulaires plus forts et une meilleure production de rAAV. Post transfection, la collecte du surnageant et la lyse des cellules est efficace et cohérente. Pour récolter le rAAV à partir de cellules, les méthodes de lyse cellulaire physique telles que la congélation-décongélation sont inefficaces et incohérentes car il n'y a aucun moyen de s'assurer que toutes les cellules sont lysées. Ici, une procédure de lyse chimique est décrite. L'utilisation d'un tampon de lyse chimique garantit que toutes les cellules sont exposées à l'agent de lyse à une concentration spécifique, ainsi qu'à des additifs tels qu'un inhibiteur de protéase pour empêcher la dégradation de la capside. Cette méthode lyse de manière plus cohérente les cellules permettant une récolte plus efficace de rAAV. En outre, le pastillage et l'élimination des débris cellulaires éliminent les contaminants possibles du lysat brut, ce qui peut augmenter le temps et le coût de filtration du lysat avant la purification.

                            Bien que le rAAV puisse être présent en grande quantité dans le lysat brut, l'acte de capture et de nettoyage du rAAV peut différer selon les différentes méthodes de purification, telles que les gradients de chlorure de césium. Ici, l'utilisation de la purification par chromatographie d'affinité sur l'héparine-sépharose fournit une méthode rapide et facile pour la purification du vecteur qui se traduit par un virus ultrapur et ne nécessite pas d'ultracentrifugation en gradient. Cependant, tous les sérotypes d'AAV ne contiennent pas de domaines de liaison à l'héparine, donc pour ces sérotypes, cette méthode de purification ne serait pas appropriée. Par exemple, alors que AAV2 et AAV6 se lient au sulfate d'héparine, AAV4 et AAV5 ne le font pas 30 . Bien que cette méthode ne soit pas universelle, elle est efficace et facile pour les capsides qui se lient au sulfate d'héparine. Contrairement aux gradients d'ultra-centrifugation tels que l'iodixanol, toutes les particules de rAAV sont liées à la membrane de la colonne jusqu'à ce qu'elles soient éluées à l'aide de lavages à haute concentration en sel, évitant ainsi les problèmes tels que le mélange des gradients et les compétences nécessaires pour récupérer les fractions du gradient. L'élution par des lavages à haute concentration en sel permet une élution contrôlée et précise du virus en fractions qui peuvent être davantage concentrées. Seule la concentration de certaines fractions du virus élué élimine davantage les contaminants potentiels tout en récupérant >97% du virus élué. Une limitation de la purification par chromatographie d'affinité sur l'héparine-sépharose est qu'elle ne fait pas la distinction entre les particules vides et pleines. Des étapes analytiques supplémentaires d'ultracentrifugation devraient être incorporées afin d'éliminer les capsides vides 31 .

                            La qPCR est une méthode économique et rapide pour déterminer le nombre de génomes vectoriels dans une préparation de vecteur AAV. Bien que la qPCR soit une méthode de quantification sensible, elle ne fournit aucune information sur le nombre de particules infectieuses dans la préparation. De plus, la sensibilité de ce test peut entraîner une variabilité, car des erreurs techniques lors du pipetage peuvent entraîner une variabilité entre les tests. Ainsi, pour toute expérience impliquant la comparaison de différents vecteurs AAV, il est essentiel que les vecteurs soient titrés sur la même plaque qPCR. Malgré ces limitations, la qPCR est la méthode la plus précise développée pour le titrage de l'AAV et est actuellement la méthode la plus largement utilisée et acceptée pour la quantification des vecteurs AAV 32 . L'utilisation d'une amorce/sonde qui se lie au polyA SV40 d'un génome de rAAV est basée sur le fait que cette séquence est conservée dans de nombreux plasmides génomiques d'AAV conçus en laboratoire. Au-delà du choix d'une séquence conservée parmi les plasmides du génome rAAV du lecteur, les sondes qPCR peuvent être conçues pour toutes les parties du génome rAAV, y compris, mais sans s'y limiter, les promoteurs, les transgènes ou les facteurs post-transcriptionnels.

                            L'évaluation de la pureté et de la qualité du produit AAV est une étape importante du processus de production. Le Western blot peut être utilisé pour détecter les protéines structurelles VP1, VP2 et VP3 qui constituent la capside de l'AAV, ainsi que toute forme altérée de VP. VP1, VP2 et VP3 sont généralement présents dans un rapport de 1:1:10, mais cela peut varier de 1:1:5 à 1:1:20 selon le sérotype. Par conséquent, il est essentiel de déterminer le rapport pour chaque système de manière empirique, en particulier parce que la région N-terminale de VP1 s'est avérée importante pour l'infectivité et la transduction 33 . La SDS-PAGE couplée à la coloration de Coomassie est une méthode assez simple pour détecter VP1, VP2 et VP3, ainsi que les contaminants protéiques de la cellule hôte. L'utilisation de colorants protéiques fluorescents tels que SYPRO Ruby offre une détection plus sensible des contaminants protéiques de la cellule hôte que Coomassie. Cependant, tous les laboratoires n'ont pas accès à l'équipement d'imagerie requis pour visualiser le gel. Enfin, les ELISA commerciaux peuvent être utilisés pour quantifier les contaminants protéiques de la cellule hôte dans les vecteurs AAV produits dans les cellules HEK293.

                            Ce protocole fournit un aperçu détaillé de la production de rAAV à titre élevé et de haute pureté pour les sérotypes qui se lient à l'héparine. Dans la section des résultats représentatifs, l'utilisation du nouveau AAV6.2FF exprimant l'hIgG dans une variété de modèles animaux montre la sécurité et l'efficacité de ce rAAV in vivo. Bien que le vecteur AAV6.2FF ait été administré par voie IM, ces virus de haute qualité et de grande pureté peuvent être administrés par différentes voies in vivo, car d'éventuels contaminants inflammatoires, tels que les protéines de la cellule hôte, ont été éliminés par nos procédés de purification.

                            Abonnement requis. Veuillez recommander JoVE à votre bibliothécaire.

                            Divulgations

                            Sarah K. Wootton est l'inventrice d'un brevet américain US10806802B2 pour la capside AAV6.2FF.

                            Remerciements

                            Amira D. Rghei, Brenna A. Y. Stevens, Sylvia P. Thomas et Jacob G. E. Yates ont reçu des bourses d'études du Collège vétérinaire de l'Ontario ainsi que des bourses d'études supérieures de l'Ontario. Amira D. Rghei a été récipiendaire d'une bourse d'études Mitacs Accélération. Ce travail a été financé par la subvention de projet des Instituts de recherche en santé du Canada (IRSC) (#66009) et une subvention de projets de recherche collaborative en santé (en partenariat avec le CRSNG) (#433339) à SKW.


                            Pays Émissions de CO2 (tonnes de dioxyde de carbone) Population 2012  Émissions par habitant  Chine 8 782 000 000 1 359 750 000    États-Unis 5 144 000 000 316 597 000   Inde 2 185 000 000 1 233 460 000  Russie  1 646 000 000

                            Un groupe de scientifiques a étudié l'effet d'un produit chimique sur diverses souches de bactéries. La souche A a commencé avec 6 000 cellules et a diminué à un taux constant de 2 000 cellules par heure après l'application du produit chimique. La souche B a commencé avec 2000 cellules et a diminué


                            Les virus oncolytiques comme plateformes d'ingénierie pour l'immunothérapie combinée

                            Pour s'appuyer efficacement sur les récents succès du blocage des points de contrôle immunitaire, de la thérapie adoptive par cellules T et des vaccins contre le cancer, il est essentiel de concevoir rationnellement des stratégies combinées qui augmenteront et étendront l'efficacité à une plus grande proportion de patients. Par exemple, la combinaison d'inhibiteurs de point de contrôle immunitaire anti-cytotoxiques associés aux lymphocytes T 4 (CTLA4) et anti-protéine de mort cellulaire programmée 1 (PD1) double essentiellement le taux de réponse chez certains patients atteints de mélanome métastatique. Cependant, étant donné l'hétérogénéité du cancer, il semble probable que des combinaisons encore plus complexes d'agents immunomodulateurs puissent être nécessaires pour obtenir des réponses thérapeutiques cohérentes et durables contre un large spectre de cancers. Cela a de sérieuses implications en termes de toxicité pour les patients, de faisabilité pour les prestataires de soins et de coûts pour les systèmes de santé. Une solution convaincante est offerte par les virus oncolytiques (OV), qui peuvent être conçus pour se répliquer sélectivement dans et détruire le tissu tumoral tout en augmentant simultanément l'immunité antitumorale. Dans cet article d'Opinion, nous soutenons que l'avenir de l'immunothérapie inclura des OV qui fonctionnent comme des plates-formes de modulation immunitaire multiplexées exprimant des facteurs tels que des inhibiteurs de point de contrôle immunitaire, des antigènes tumoraux, des cytokines et des agents d'activation des cellules T. Nous illustrons ce concept en suivant les essais et les tribulations des cellules T réactives aux tumeurs depuis leur amorçage initial jusqu'à l'exécution de la fonction effectrice cytotoxique dans le lit tumoral. Nous soulignons la myriade d'opportunités pour les OV d'aider à surmonter les obstacles critiques dans le voyage des cellules T, conduisant à de nouveaux mécanismes synergiques dans la lutte contre le cancer.


                            Vecteurs

                            Sont également présentés des vecteurs recombinants comprenant un ou plusieurs des polynucléotides décrits ci-dessus. Un vecteur décrit ici peut être utilisé en conjonction avec un ou plusieurs autres vecteurs (par exemple, 1, 2, 3 ou plusieurs vecteurs) décrits ici comme un système vectoriel, qui peut être utilisé pour générer des RhAds recombinants défectueux pour la réplication (rdsRhAds) ou RhAds compétents pour la réplication (rcsRhAds) décrits ici. En conséquence, sont présentés des systèmes de vecteurs d'adénovirus pour chacun des quatorze adénovirus (RhAd54-RhAd67) décrits ici. Un tel système de vecteur peut être utilisé pour générer des adénovirus défectueux pour la réplication selon des procédés connus dans l'art, qui ont été appliqués pour générer des lots exempts d'adénovirus compétents pour la réplication basés, par exemple, sur Ad5, Ad11, Ad35 et Ad49 (voir, par ex. , WO 97/00326, WO 00/70071 WO 02/40665 Publication US n° 2005/0232900, tous incorporés ici par référence).

                            Les vecteurs décrits ici peuvent contenir la région El (par exemple, une séquence ayant au moins 90 % d'identité de séquence avec une région El définie dans le tableau 3) dans le but de produire des rcsRhAds.

                            Les vecteurs décrits ici peuvent contenir les séquences RhAd d'extrémité gauche et une cassette d'expression/transgène. La cassette d'expression du vecteur peut remplacer ou perturber tout ou partie de la région E1 de l'adénovirus. La cassette d'expression peut inclure, par exemple, un promoteur (par exemple, un promoteur CMV, par exemple, un promoteur CMVlong) qui stimule l'expression d'un transgène, et, éventuellement, un signal de poly-adénylation (par exemple, une séquence nucléotidique hétérologue codant pour un gène antigénique produit d'intérêt, par exemple, une protéine bactérienne, virale, parasitaire, fongique ou thérapeutique, ou un fragment de celle-ci). La région El (par exemple, une séquence ayant au moins 90 % d'identité de séquence avec une région El définie dans le tableau 3) peut être supprimée (partiellement ou complètement), interrompue ou rendue inactive par une ou plusieurs mutations. De tels vecteurs sont illustrés, par exemple, dans les vecteurs vides décrits ici (voir, par exemple, les figures 8, 10, 12, 13, 17, 19, 20, 23, 24, 27, 29, 31, 33, 35, 37 , 39, 40 et 44, qui décrivent les vecteurs vides correspondant aux SEQ ID NO : 224, 226, 228, 229, 234, 236, 237, 240, 241, 244, 246, 248, 250, 252, 254, 256 , 257 et 262, qui manquent de la région E1 pour chacun de RhAd54-RhAd67).

                            Les vecteurs décrits ici peuvent contenir la partie gauche des séquences RhAd (par exemple, la partie gauche de l'un quelconque de RhAd54-RhAd67), qui comprend la base du penton et les régions codantes 52K du RhAd, et/ou la partie droite du RhAd (par exemple, la partie droite de l'un quelconque du génome RhAd54-RhAd67 d'environ pVII à l'ITR droit (rITR)). Les vecteurs décrits ici peuvent contenir la partie gauche des séquences RhAd (par exemple, la partie gauche de l'un quelconque de RhAd54-RhAd67), qui comprend les régions codantes pIX et pIVa2 du RhAd, et/ou la partie droite des séquences RhAd (par exemple, la partie droite de l'un quelconque du génome RhAd54-RhAd67 d'environ pIX au rITR).

                            Les vecteurs décrits ici peuvent avoir une E3 (dE3) supprimée, interrompue ou mutée (par exemple, une séquence ayant au moins 90 % d'identité de séquence avec une région E3 définie dans le tableau 3) et/ou une région E4 (dE4) (par exemple, un séquence ayant au moins 90 % d'identité de séquence avec une région E4 définie dans le tableau 3), qui n'est pas requise pour la réplication et l'encapsidation de la particule adénovirale. Par exemple, tout ou partie de la région E3 et/ou E4 peut être supprimé. De tels vecteurs sont illustrés, par exemple, dans les vecteurs pWe/RhAd.pIX-rITR décrits ici (voir, par exemple, les figures 9, 11, 13-16, 18, 21, 22, 25, 26, 28, 30, 32 , 34, 36, 38, 41-43 et 45, qui représentent des vecteurs correspondant aux SEQ ID NO : 225, 227, 230-233 234, 235, 238, 239, 242, 243, 245, 247, 249, 251, 253, 255, 258-261 et 263, qui manquent de la région E3 pour chacun de RhAd54-RhAd67).

                            La suppression de la région E3 est généralement préférée si de grandes séquences transgéniques (par exemple, une séquence d'acide nucléique codant pour un polypeptide hétérologue (par exemple, un antigène d'un agent infectieux ou d'un cancer), comme décrit ici) doivent être incorporées dans le vecteur puisque le génome la taille qui peut être conditionnée dans une particule fonctionnelle est limitée à environ 105 % de la taille de type sauvage. Il est entendu que d'autres modifications peuvent être introduites dans le génome adénoviral, telles que la délétion de la région E2A.

                            Une cellule transfectée avec un vecteur décrit ici peut compléter ces déficiences en délivrant la fonctionnalité de la ou des régions manquantes. La région E2A peut être fournie, par exemple, par un mutant E2A sensible à la température, ou en délivrant les fonctions E4. Les cellules qui peuvent être utilisées pour compléter une déficience d'un gène adénoviral (par exemple, une délétion E1, E3 et/ou E4) d'un vecteur décrit ici comprennent, par exemple, les cellules 293 ou d'autres cellules complémentant El.

                            Les vecteurs adénoviraux rhésus de l'invention peuvent être formés efficacement lors de la transfection des constructions de vecteurs Ad dans une lignée cellulaire existante de complément d'El exprimant en outre la protéine 55k (par exemple, la protéine 55k des sérotypes 5 et 35 d'Ad humain, sérotype 52 de l'Ad rhésus (voir, par exemple, GenBank Accession No. AIY35078) et 59, ou d'autres sérotypes Ad connus). 55k peut être fourni aux cellules pour fabriquer les vecteurs viraux revendiqués via une co-expression dans les cellules (par exemple, par co-transfection dans les cellules ou par intégration de cellules hôtes). La co-expression de 55k favorise une recombinaison efficace de l'ADN et donc la formation de virus recombinants sur des lignées cellulaires existantes de complément d'El.

                            La protéine RhAd52 55k a la séquence suivante :

                            De nombreux systèmes d'expression de vecteurs viraux sont connus dans l'art et les modifications des génomes adénoviraux entrent dans le cadre de la présente invention, qui, en principe, concerne les quatorze RhAds décrits ici (RhAd54-RhAd67) leurs séquences génomiques, ou des parties de celles-ci, leurs variantes et leur utilisation. Comme décrit ci-dessus, n'importe quel vecteur décrit ici peut être utilisé conjointement avec un ou plusieurs autres vecteurs décrits ici. Dans certains modes de réalisation, des vecteurs sont utilisés qui codent à la fois pour les côtés gauche et droit du génome RhAd afin de générer un RhAd donné décrit ici.

                            Sont également présentés des vecteurs pour la génération d'adénovirus chimériques qui comprennent une partie d'un ou plusieurs des génomes RhAd54-RhAd67, ainsi qu'une partie du génome d'un ou plusieurs autres virus. Les vecteurs adénoviraux chimériques peuvent comprendre une substitution de tout ou d'une partie, par exemple, de l'hexon et/ou de la protéine fibreuse de RhAd54-RhAd67. Par exemple, une partie ou la totalité de la protéine hexon de RhAd54-RhAd67 peut être remplacée par celle d'un autre virus (p. 2 d'une protéine hexon de l'un quelconque de RhAd54-RhAd67).

                            La partie ou la totalité de la protéine fibreuse de RhAd54-RhAd67 peut être substituée par celle d'un autre virus. Par exemple, le domaine de bouton de fibre de RhAd54-RhAd67 peut être substitué. Les régions substituées peuvent être remplacées par une région dérivée d'un adénovirus qui a une séroprévalence inférieure à celle d'Ad5, comme le sous-groupe B (Ad11, Ad34, Ad35 et Ad50) et le sous-groupe D (Ad15, Ad24, Ad26, Ad48, et Ad49) les adénovirus, ainsi que les adénovirus simiens (par exemple, Pan9, également connu sous le nom d'AdC68). Un squelette de vecteur adénoviral d'Ad5, Ad11, Ad15, Ad24, Ad26, Ad34, Ad48, Ad49, Ad50 ou Pan9/AdC68 peut également être utilisé pour préparer un vecteur qui inclut une substitution de tout ou partie d'un ou plusieurs des au-dessus des HVR d'hexon de RhAd54-RhAd67.


                            Plus d'information

                            Politique de sécurité Internet

                            En utilisant ce site, vous acceptez la surveillance et l'audit de sécurité. Pour des raisons de sécurité et pour garantir que le service public reste disponible pour les utilisateurs, ce système informatique gouvernemental utilise des programmes pour surveiller le trafic réseau afin d'identifier les tentatives non autorisées de télécharger ou de modifier des informations ou de causer des dommages, y compris des tentatives de refus de service aux utilisateurs.

                            Les tentatives non autorisées de télécharger des informations et/ou de modifier des informations sur n'importe quelle partie de ce site sont strictement interdites et sont passibles de poursuites en vertu du Computer Fraud and Abuse Act de 1986 et du National Information Infrastructure Protection Act de 1996 (voir Titre 18 USC §§ 1001 et 1030).

                            Pour garantir que notre site Web fonctionne bien pour tous les utilisateurs, la SEC surveille la fréquence des demandes de contenu SEC.gov pour s'assurer que les recherches automatisées n'affectent pas la capacité des autres à accéder au contenu SEC.gov. Nous nous réservons le droit de bloquer les adresses IP qui soumettent des demandes excessives. Les directives actuelles limitent les utilisateurs à un total de 10 demandes par seconde maximum, quel que soit le nombre de machines utilisées pour soumettre des demandes.

                            Si un utilisateur ou une application soumet plus de 10 demandes par seconde, les demandes supplémentaires provenant de la ou des adresses IP peuvent être limitées pendant une brève période. Une fois que le taux de demandes est tombé en dessous du seuil pendant 10 minutes, l'utilisateur peut reprendre l'accès au contenu sur SEC.gov. Cette pratique de la SEC est conçue pour limiter les recherches automatisées excessives sur SEC.gov et n'est pas censée ou susceptible d'avoir un impact sur les personnes naviguant sur le site Web SEC.gov.

                            Notez que cette politique peut changer car la SEC gère SEC.gov pour s'assurer que le site Web fonctionne efficacement et reste disponible pour tous les utilisateurs.

                            Noter: Nous n'offrons pas de support technique pour le développement ou le débogage de processus de téléchargement scriptés.