Informations

Comment construire une bibliothèque sgRNA avec plusieurs échantillons ?

Comment construire une bibliothèque sgRNA avec plusieurs échantillons ?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Je me demandais si quelqu'un avait déjà de l'expérience dans la construction de bibliothèques de sgRNA. Nous sommes intéressés à faire une expérience knock-out (perte de fonction) avec 5 conditions différentes. J'ai trouvé ce protocole de Joung et al.

Dans le protocole, ils ont 10 amorces Fwd différentes sans codes-barres uniques, seules les huit amorces Rev contiennent des codes-barres uniques pour différents échantillons en KO. Dois-je bien comprendre que je ne peux regrouper que huit échantillons en un seul cycle de séquençage avec ce protocole ?

J'aimerais mieux comprendre le protocole de construction d'une bibliothèque ngs pour les échantillons d'ARNsg. Si quelqu'un peut m'indiquer le bon lien/page ?

Existe-t-il des kits de préparation de bibliothèques plus complexes pouvant traiter plus d'échantillons ?


Bibliothèque CRISPR-Cas9 humaine minimale à l'échelle du génome

Les bibliothèques d'ARN du guide CRISPR ont été améliorées de manière itérative pour fournir des réactifs de plus en plus efficaces, bien que leur grande taille soit un obstacle pour de nombreuses applications. Nous concevons une bibliothèque CRISPR-Cas9 humaine minimale optimisée à l'échelle du génome (MinLibCas9) en exploitant des ensembles de données de perte de fonction de gènes existants à grande échelle, ce qui entraîne une réduction de plus de 42 % de la taille par rapport aux autres bibliothèques CRISPR-Cas9 tout en préservant le dosage sensibilité et spécificité. MinLibCas9 offre une rétrocompatibilité avec les ensembles de données existants, augmente la plage dynamique des écrans CRISPR-Cas9 et étend leur application aux modèles et analyses complexes.


Plusieurs outils Web disponibles

Les outils de conception de sgRNA basés sur le Web exigent généralement que les utilisateurs saisissent une séquence d'ADN, un emplacement génomique ou un nom de gène pour chaque gène d'intérêt et indiquent une espèce. Un algorithme spécifique à chaque outil génère une liste de séquences guides candidates avec les sites hors cible prévus correspondants pour chaque entrée (Wu et al. 2014). La plupart des outils visent à fournir des séquences de guidage qui minimisent la probabilité d'effets hors cible, mais les méthodes qu'ils emploient varient. Par exemple, Chop Chop utilise des données empiriques provenant de plusieurs publications récentes (par exemple, Doench et al. 2016) pour calculer les scores d'efficacité. Alternativement, CasFinder (Aach et al. 2014) et E-CRISP (Heigwer et al. 2014) intègrent des pénalités spécifiques définies par l'utilisateur en fonction du nombre et de la position des discordances par rapport à la séquence de guidage afin de classer le potentiel de non-cible effets.


Matériel et méthodes

Pour un aperçu graphique des procédures, voir la figure 1. Les plasmides pGlo et BPK764 provenaient de Bio-rad (CA, USA) et Addgene (MA, USA). Réactifs de biologie moléculaire de New England Biolabs (NEB, MA) : BsaI-HF (R3535S), NEB 5-alpha Competent E. coli Cellules haute efficacité (C2987I), cellules compétentes T7 Express (C2566I), kit de déphosphorylation rapide (M0508S), T4 ligase (M0202S), Monarch Plasmid MiniPrep Kit (T1010S), GeneJET PCR Purification Kit (K0701), Sigma-Aldrich (MO, USA) : Arabinose (A3256), Isopropyl β-d -1-thiogalactopyranoside (IPTG, 1678), Chloramphénicol (C0378) et Ampicilline (A9518). Tous les oligonucléotides ont été obtenus auprès de Integrated DNA Technologies (IA, USA).

Conception d'ARNr

Toutes les séquences ont été manipulées en utilisant A Plasmid Editor (ApE, http://jorgensen.biology.utah.edu/wayned/ape/). La séquence pour GFP dans pGlo a été scanné à la recherche de sites PAM potentiels (5'-NGG-3', N est n'importe quel nucléotide). Une séquence de 20 paires de bases immédiatement en amont d'une séquence PAM identifiée a été utilisée pour concevoir une paire d'oligonucléotides complémentaires (tableau 1) qui peuvent être annelés pour produire des ADN double brin qui servent de base aux ARNcr contre GFP. Des surplombs compatibles Bsal de 5′-ATAG-3′ (oligo avant, supérieur) et 5′'-AAAC (oligo inverse, inférieur) ont été ajoutés pour la ligature des oligonucléotides en duplex codant pour les ARNr dans le plasmide d'expression ARN/cas-9 à guide unique BPK764 . Tous les oligonucléotides ont été ordonnés 5'-phosphorylés pour augmenter l'efficacité de la ligature. Alternativement, les oligonucléotides peuvent être phosphorylés en laboratoire en utilisant la polynucléotide kinase T4 (NEB). Pour duplexer des oligonucléotides d'ARNcr complémentaires, les ADN sont dilués à 10 M chacun dans un tampon d'hybridation (10 mM Tris, 1 mM EDTA, 50 mM NaCl, pH 8,0) et annelés par incubation à 95 °C pendant 5 minutes et refroidissement à 1 °C tous les minute jusqu'à 26 °C.

Séquences crRNA insérées dans le plasmide sgRNA Séquence (5′-3′)
sgRNA 1 UNE ÉTIQUETTE CCAATTCTTGTTGAATTAGA
AAAC TCTAATTCAACAAGAATTGG
sgRNA 2 UNE ÉTIQUETTE AAAGGAGAAGAACTTTTCAC
AAAC GTGAAAAGTTCTTCTCCTTT
sgRNA 3 UNE ÉTIQUETTE CTGGAAAACTACCTGTTCCA
AAAC TGGAACAGGTAGTTTTCCAG
sgRNA 4 UNE ÉTIQUETTE GAATTAGATGGGTGATGTTAA
AAAC TTAACATCACCATCTAATTC
Amorce de séquençage BPK764 GACTACAAAGACCATGACGGTG

Construction d'un plasmide expérimental d'expression d'ARNsg

Le plasmide BPK764 a été linéarisé avec Bsal-HF et déphosphorylé avec le kit de déphosphorylation rapide (NEB) et purifié avec le kit de purification GeneJet PCR (ThermoFisher). La digestion par Bsal de BPK764 aboutit à des extrémités non compatibles pour le clonage directionnel d'oligonucléotides codant pour l'ARNcr duplexé. Les réactions de ligature ont utilisé 20 et 60 fmol de duplex d'ADNdb hybridés et 100 ng de plasmide linéarisé déphosphorylé. Cinq microlitres de chaque ligature ont été transformés en 50 ?? L de cellules compétentes NEB 5-alpha avec méthode de choc thermique de 30 secondes à 42 °C. Après sauvetage sous agitation à 37 °C pendant 1 heure avec 1 mL de milieu Luria-Bertani (LB), 100 ?? L de transformation a été étalé sur plaque LB contenant 25 ?? g/mL de chloramphénicol (LBCm). Les plaques ont été incubées une nuit à 37°C. Cinq colonies ont été prélevées et cultivées dans des milieux LBcm, et les plasmides ont été purifiés par purification miniprep (NEB). Les plasmides ont été séquencés pour vérification (Eurofins).

CRISPR-cas9 Désactivation de GFP

Le plasmide BPK764 de contrôle ou la séquence vérifiée contenant le plasmide crRNA et pGlo ont été co-transformés dans des cellules compétentes T7 Express par la méthode du choc thermique et étalés sur des plaques LB additionnées de chloramphénicol (25 ?? g/mL) et l'ampicilline (50 ?? g/mL) pour la sélection des deux plasmides. Les plaques ont été incubées une nuit à 37°C. Les cellules bactériennes exprimant la polymérase T7 sont nécessaires pour piloter l'expression à la fois du sgRNA et du cas9. Les étudiants ont ensuite choisi une seule colonie de leur plaque témoin et expérimentale dans 1 ml de LB pour effectuer des dilutions en série 1:100 dans six tubes LB de 1 ml. Une dilution en série a été effectuée pour s'assurer que les étudiants disposent d'une plaque avec 50 à 100 colonies qui peuvent être facilement comptées (Informations complémentaires Fig. S1). Un échantillon de 100 ?? L de chaque dilution a été étalé sur des plaques LB contenant 10 mM d'arabinose (pour l'expression de la GFP), 500 nM d'IPTG (pour l'induction de l'expression sgRNA et cas9) et 25 ?? g/mL Cm (sélection plasmide sgRNA/cas9). L'ampicilline n'a pas été ajoutée aux plaques pour permettre aux cellules bactériennes qui contenaient des cellules pGlo contenant des gènes résistants à la GFP et à l'ampicilline de se développer si cas9 coupait avec succès la GFP dans le plasmide pGlo. Les plaques ont été incubées une nuit à 37°C.


Concevez votre plasmide et commandez des amorces (voir la figure à droite).

Lors de la conception de votre plasmide, pensez aux segments d'ADN que vous devrez joindre pour créer votre plasmide final. Les segments adjacents doivent avoir des séquences identiques aux extrémités (séquences A et B sur les figures). Ces séquences identiques peuvent être créées par PCR avec des amorces qui contiennent une extrémité 5' identique à un segment adjacent et une extrémité 3' qui s'hybride à la séquence cible.

Une stratégie consiste à commander des amorces d'une longueur de 60 pb, avec 30 pb correspondant à l'extrémité du fragment adjacent et 30 pb s'hybridant à la séquence cible.

Évitez les structures secondaires fortes dans la région d'homologie. Les épingles à cheveux dans cette région peuvent réduire considérablement l'efficacité du recuit de deux extrémités homologues.

Générez des segments d'ADN par PCR.

Exécutez le produit PCR sur un gel d'agarose pour vérifier la taille et le rendement. S'il y a des quantités importantes de produit indésirable, purifiez les segments d'ADN sur gel. Sinon, la purification PCR ou même le mélange PCR brut peuvent très bien fonctionner dans un assemblage si vous souhaitez gagner du temps.

Combinez des segments dans Gibson Assembly Reaction. Noter: Les rendements seront meilleurs lorsque les fragments d'ADN sont présents en concentrations équimolaires.

Le Gibson Cloning Master Mix se compose de trois enzymes différentes dans un seul tampon. Chaque enzyme a une fonction spécifique et unique pour la réaction :

  • Exonucléase T5 - crée des surplombs d'ADN simple brin 3' en mâchant à partir de l'extrémité 5' de l'ADN. Des fragments d'ADN complémentaires peuvent ensuite s'hybrider les uns aux autres.
  • Phusion ADN polymérase - incorpore des nucléotides pour "remplir" les lacunes dans les fragments d'ADN hybridés.
  • Taq ADN ligase - joint de manière covalente les fragments d'ADN complémentaires recuits, en supprimant toutes les entailles et en créant un fragment d'ADN contigu.

Incuber le mélange pendant 1 heure à 50°C ou suivre les instructions du fabricant. Vous pouvez acheter un master mix auprès d'une entreprise (par exemple, NEB ou SGI-DNA), ou créer le vôtre (par exemple, Miller Lab Protocol).

Transformez l'ADN en bactéries et recherchez le produit plasmidique correct par Restriction Digest.

Séquencez les régions importantes de votre plasmide final, en particulier les coutures entre les pièces assemblées.


Conclusion

Nous concluons que la réalisation d'écrans de viabilité CRISPR/Cas9 à l'aide de bibliothèques de sgRNA de nouvelle génération conçues de manière empirique et de clones monocellulaires Cas9 fortement modifiés améliore la résolution des écrans CRISPR et permet de différencier également les phénotypes de viabilité subtils, ce qui permet à son tour la détection de coups avec un plus petit nombre de sgRNA par gène. Nous montrons que la conception empirique des bibliothèques de sgRNA basée sur les preuves phénotypiques des écrans précédents est un prédicteur approprié de l'efficacité de coupe des sgRNA et permet la sélection de guides hautement actifs, que nous avons assemblés dans une bibliothèque CRISPR à l'échelle du génome appelée « bibliothèque HD CRISPR ».


MATÉRIAUX

RÉACTIFS

Préparation sgRNA

Plasmides : pSpCas9 (ID plasmide Addgene : 48137), pSpCas9(BB) (anciennement pX330 ID plasmide Addgene : 42230), pSpCas9(BB)-2A-GFP (ID plasmide Addgene : 48138), pSpCas9(BB)-2A-Puro ( ID de plasmide Addgene : 48139), pSpCas9n(BB) (ID de plasmide Addgene : 48873), pSpCas9n(BB)-2A-GFP (ID de plasmide Addgene : 48140), pSpCas9n(BB)-2A-Puro (ID de plasmide Addgene : 48141) . Les fichiers GenBank annotés pour les plasmides sont disponibles via Addgene et http://www.genome-engineering.org/

pUC19 (Invitrogen, n° cat. 15364-011) ou tout plasmide de clonage préféré

Les amorces ou oligos de PCR pour la construction de sgRNA sont répertoriés dans Tableau 1 et en Données supplémentaires 1. Les amorces de plus de 60 pb peuvent être commandées sous forme d'ultramères de 4 nmol (Integrated DNA Technologies)

Eau distillée sans DNase/RNase UltraPure (Life Technologies, n° cat. 10977-023)

Polymérase de fusion Herculase II avec tampon de réaction 5× (Agilent Technologies, référence 600679) ▲ CRITIQUE Pour minimiser les erreurs d'amplification des sgRNA, il est important d'utiliser une polymérase haute fidélité. D'autres polymérases haute fidélité, telles que PfuUltra (Agilent) ou Kapa HiFi (Kapa Biosystems), peuvent être utilisées comme substituts.

Taq ADN polymérase avec tampon Taq standard (NEB, n° cat. M0273S)

Mélange de solution dNTP, 25 mM chacun (Enzymatics, n° cat. N205L)

MgCl2, 25 mM (Thermo Scientific, n° cat. R0971)

Kit d'extraction de gel QIAquick (Qiagen, réf. 28704)

Kit QIAprep spin miniprep (Qiagen, réf. 27106)

Tampon UltraPure TBE, 10× (Life Technologies, n° cat. 15581-028)

Agarose SeaKem LE (Lonza, n° cat. 50004)

Échelle d'ADN Plus de 1 ko (Life Technologies, n° cat. 10787-018)

Tampon de chargement TrackIt CyanOrange (Life Technologies, réf. 10482-028)

FastDigest BbsI (BpiI) (Fermentas/Thermo Scientific, référence FD1014)

Tampon Fermentas Tango (Fermentas/Thermo Scientific, n° cat. BY5)

TNT (Fermentas/Thermo Scientific, réf. R0862)

ADN ligase T7 avec tampon de ligature rapide 2× (Enzymatics, n° cat. L602L). Des ligases alternatives, telles que l'ADN ligase T4, peuvent également être utilisées. Si vous utilisez d'autres ligases, remplacez-les par le tampon compatible

T4 polynucléotide kinase (New England BioLabs, n° cat. M0201S)

Tampon de réaction T4 DNA ligase, 10× (New England BioLabs, n° cat. B0202S)

Adénosine 5′-triphosphate, 10 mM (New England BioLabs, n° cat. P0756S)

DNase dépendante de l'ATP PlasmidSafe (Epicentre, n° cat. E3101K)

One Shot Stbl3 chimiquement compétent E. coli (Life Technologies, n° cat. C7373-03)

Milieu SOC (New England BioLabs, n° cat. B9020S)

Milieu LB (Sigma, réf. L3022)

Milieu gélosé LB (Sigma, n° cat. L2897)

Ampicilline, 100 mg ml 𠄱 , stérilisée par filtration (Sigma, n° cat. A5354)

Culture de cellules de mammifères

Cellules HEK 293FT (Life Technologies, réf. R700-07)

Lignée cellulaire HUES 9 (Harvard Stem Cell Science)

DMEM, glucose élevé (Life Technologies, n° cat. 10313-039)

DMEM, haute teneur en glucose, sans rouge de phénol (Life Technologies, n° cat. 31053-028)

PBS de Dulbecco (DPBS Life Technologies, n° cat. 14190-250)

FBS, qualifié et inactivé à la chaleur (Life Technologies, n° cat. 10438-034)

Milieu à sérum réduit Opti-MEM I (Life Technologies, n° cat. 11058-021)

Pénicilline-streptomycine, 100× (Life Technologies, n° cat. 15140-163)

Dichlorhydrate de puromycine (Life Technologies, n° cat. A11138-03)

TrypLE Express, sans rouge de phénol (Life Technologies, n° cat. 12604-013)

Réactif de transfection Lipofectamine 2000 (Life Technologies, n° cat. 11668027)

Lignée cellulaire Amaxa SF 4D-Nucleofector X kit S, 32 RCT (Lonza, réf. V4XC-2032)

Matrice de membrane basale sans facteur de croissance réduit Geltrex LDEV (Life Technologies, n° cat. A1413201)

Milieu mTeSR1 (Stemcell Technologies, n° cat. 05850)

Normocin (InvivoGen, cat. n° ant-nr-1)

Solution de détachement cellulaire Accutase (Stemcell Technologies, n° cat. 07920)

Inhibiteur de la protéine kinase associée à la Rho (ROCK) (Y-27632 Millipore, n° cat. SCM075)

Amaxa P3 cellule primaire 4D-Nucleofector X kit S, 32 RCT (Lonza, réf. V4XP-3032)

Analyse de génotypage

Amorces PCR pour SURVEYOR, analyse RFLP ou séquençage voir Tableau 1 , Données supplémentaires 1 (alternativement, ils peuvent être faits sur mesure)

Solution d'extraction d'ADN QuickExtract (Epicentre, réf. QE09050)

Kit de détection de mutation SURVEYOR pour électrophorèse sur gel standard (Transgenomic, n° cat. 706025)

Gels TBE, 4�%, 1,0 mm, 15 puits (Life Technologies, réf. C62255BOX)

Tampon d'échantillon Novex Hi-Density TBE, 5× (Life Technologies, référence LC6678)

Colorant en gel d'acide nucléique SYBR Gold, 10 000× (Life Technologies, n° cat. S-11494)

FastDigest HindIII (Fermentas/Thermo Scientific, référence FD0504)

Tampon FastDigest, 10× (Fermentas/Thermo Scientific, fourni avec FastDigest HindIII)

Phosphatase antarctique FastAP (Fermentas/Thermo Scientific, n° cat. EF0654)

Kit d'indexation Nextera XT (Illumina, réf. FC-131-1001)

ÉQUIPEMENT

Pointes de pipettes stériles filtrées (Corning)

Microtubes à centrifuger standard, 1,5 ml (Eppendorf, réf. 0030 125.150)

Plaques PCR Axygen, 96 puits (VWR, n° cat. PCR-96M2-HSC)

Tubes PCR Axygen 8-Strip (Fischer Scientific, n° cat. 14-222-250)

Tubes Falcon, polypropylène, 15 ml (BD Falcon, réf. 352097)

Tubes Falcon, polypropylène, 50 ml (BD Falcon, réf. 352070)

Tube à fond rond avec bouchon filtre à cellules, 5 ml (BD Falcon, réf. 352235)

Boîtes de Pétri, 60 mm × 15 mm (BD Biosciences, n° cat. 351007)

Plaque de culture tissulaire, 24 puits (BD Falcon, n° cat. 353047)

Plaque de culture tissulaire, 96 puits à fond plat (BD Falcon, n° cat. 353075)

Boîte de culture tissulaire, 100 mm (BD Falcon, réf. 353003)

Nunc EasYFlask 225 cm 2 (flacon T225), bouchon filtrant, volume utile 70 ml (Thermo Scientific, réf. 159934)

Nunc EasYFlask 75 cm 2 (flacon T75), bouchon filtrant, volume de travail 25 ml (Thermo Scientific, réf. 156499)

Hémocytomètre jetable INCYTO C-Chip (VWR, n° cat. 82030-468)

Unité de filtration Steriflip-GP, 0,22 μM (Millipore, référence SCGP00525)

Thermocycleur avec fonctionnalité de pas de température programmable, 96 puits (Applied Biosystems Veriti, n° cat. 4375786)

Microcentrifugeuses de bureau (par exemple, Eppendorf, n° cat. 5424 et 5804)

Système d'électrophorèse sur gel (alimentation de base PowerPac, Bio-Rad, réf. 164-5050) et plateau de gel Sub-Cell GT System (Bio-Rad, réf. 170-4401)

Mini-cellule Novex XCell SureLock (Life Technologies, référence EI0001)

Système d'imagerie numérique sur gel (GelDoc EZ, Bio-Rad, n° de cat. 170-8270) et plateau d'échantillon bleu (Bio-Rad, n° de cat. 170-8273)

Transilluminateur à lumière bleue et lunettes à filtre orange (SafeImager 2.0 Invitrogen, réf. G6600)

Logiciel de quantification de gel (Bio-Rad, ImageLab ou ImageJ open source des National Institutes of Health (NIH), États-Unis, disponible sur http://rsbweb.nih.gov/ij/)

Spectrophotomètre UV (NanoDrop 2000c, Thermo Scientific)

CONFIGURATION DU RÉACTIF

Solution d'électrophorèse TBE

Diluer le tampon TBE dans de l'eau distillée jusqu'à une solution de travail 1× et le conserver à température ambiante (18� ଌ) jusqu'à 6 mois.

ATP, 10 mM

Divisez la solution en aliquotes et stockez-les à � ଌ jusqu'à 1 an pour éviter les cycles de gel-dégel répétés.

TNT, 10 mm

Préparer la solution en ddH2O, divisez-le en aliquotes et stockez-les à � ଌ jusqu'à 2 ans. Utilisez une nouvelle aliquote pour chaque réaction, car le DTT est facilement oxydé.

Milieu de culture D10

Pour la culture de cellules HEK 293FT, préparez le milieu D10 en complétant le DMEM avec GlutaMAX et 10 % (vol/vol) de FBS. Pour la culture et l'entretien de lignées cellulaires de routine, le milieu D10 peut être complété par 1× pénicilline-streptomycine. Conservez le support à 4 ଌ jusqu'à 1 mois.

Milieu de culture mTeSR1

Pour la culture de cellules souches embryonnaires humaines (CSEh), préparer le milieu mTeSR1 en le complétant avec la solution de supplément fournie avec le milieu et 100 μg ml 𠄱 Normocin. Le milieu préparé peut être conservé à 4 ଌ jusqu'à 2 mois.


Remerciements

Nous remercions Evan Olson et Sebastián Castillo-Hair pour des discussions utiles sur la conception de circuits génétiques, le Dr Joel Moake pour l'utilisation de son cytomètre en flux, le Dr Matthew Bennett pour nous avoir offert un plasmide hébergeant cas9, et Sebastián Castillo-Hair pour la construction des plasmides pSC31_1 et pSC31_3 exprimant dCas9. Ce travail a été soutenu par l'Office of Naval Research (YIP N00014-14-1-0487) et la National Science Foundation (NSF) des États-Unis (CAREER 1553317). Le JTS a également été soutenu par le Programme de bourses de recherche d'études supérieures de la NSF (GRFP) (DGE-0940902).


Mots clés

L'édition du génome est devenue une approche de routine pour étudier la fonction des gènes in vivo. Le développement récent de systèmes basés sur CRISPR/Cas9 a ouvert de nouvelles portes pour l'édition du génome en simplifiant les exigences de ciblage du génome, en particulier par rapport aux nucléases à doigt de zinc et aux TALEN (Gaj et al., Reference Gaj, Gersbach et Barbas 2013). Le système nécessite une nucléase (Cas9), un ARN de guidage unique artificiel (sgRNA) et une courte séquence en amont du site de liaison du sgRNA appelé Protospacer Adjacent Motif (PAM), qui a la séquence 5 -NGG-3 ′ (Gasiunas et al., Référence Gasiunas, Barrangou, Horvath et Siksnys 2012 Jinek et al., Référence Jinek, Chylinski, Fonfara, Hauer, Doudna et Charpentier 2012). Une partie du sgRNA est complémentaire de 20 nucléotides dans la région ciblée du génome, et le reste est responsable de la stabilisation du complexe Cas9/sgRNA.

L'interaction du complexe Cas9/sgRNA avec le site cible permet aux domaines d'endonucléase de Cas9 de générer une rupture double brin. De telles ruptures peuvent être réparées soit par la voie de jonction des extrémités non homologues (NHEJ) soit par la voie de réparation dirigée par homologie (HDR). NHEJ est sujet aux erreurs et peut introduire de petites insertions ou suppressions qui peuvent perturber les cadres de lecture ouverts (Ma et al., Reference Ma, Lu, Tippin, Goodman, Shimazaki, Koiwai, Hsieh, Schwarz et Lieber 2004 Phillips & Morgan, Référence Phillips et Morgan 1994). Dans le cas du HDR, un modèle de donneur complémentaire à la cible doit être présent pour introduire une région spécifique dans le génome d'intérêt (Gratz et al., Reference Gratz, Ukken, Rubinstein, Thiede, Donohue, Cummings et O'Connor- Giles 2014 Liang et al., Référence Liang, Han, Romanienko et Jasin 1998). Le CRISPR/Cas9 et les systèmes associés ont été utilisés pour générer des knock-out (Chang et al., Reference Chang, Sun, Gao, Zhu, Xu, Zhu, Xiong and Xi 2013 Li et al., Reference Li, Qiu, Shao, Chen, Guan, Liu, Li, Gao, Wang, Lu, Zhao et Liu 2013), knock-ins (Auer et al., Reference Auer, Duroure, De Cian, Concordet et Del Bene 2014 Platt et al., Reference Platt, Chen, Zhou, Yim, Swiech, Kempton, Dahlman, Parnas, Eisenhaure, Jovanovic, Graham, Jhunjhunwala, Heidenreich, Xavier, Langer, Anderson, Hacohen, Regev, Feng et Zhang 2014) et de supprimer des gènes entiers (Canver et al., Référence Canver, Bauer, Dass, Yien, Chung, Masuda, Maeda, Paw et Orkin 2014) chez plusieurs espèces dont la plante Arabidopsis thaliana (Feng et al., Référence Feng, Zhang, Ding, Liu, Yang, Wei, Cao, Zhu, Zhang, Mao et Zhu 2013 Référence Feng, Mao, Xu, Zhang, Wei, Yang, Wang, Zhang, Zheng, Yang, Zeng, Liu et Zhu 2014 Hyun et al., Référence Hyun, Kim, Cho, Choi, Kim et Coupland 2015 Peterson et al., Référence Peterson, Haak, Nishimura, Teixeira, James, Dangl et Nimchuk 2016).

Alors que la génération de mutants à l'aide de CRISPR/Cas9 est relativement facile, l'identification des mutations souhaitées nécessite souvent le dépistage de nombreux événements. Deux approches courantes pour dépister les mutations induites sont le séquençage de Sanger (Fauser et al., Reference Fauser, Schiml and Puchta 2014 Feng et al., Reference Feng, Mao, Xu, Zhang, Wei, Yang, Wang, Zhang, Zheng, Yang, Zeng, Liu et Zhu 2014) ou le test T7 Endonucléase1 (T7E1) (Ablain et al., Référence Ablain, Durand, Yang, Zhou et Zon 2015 Xie &Yang, Référence Xie et Yang 2013) appliqué à des produits de PCR individuels. Malheureusement, aucune des deux méthodes ne fournit immédiatement une identification précise des mutations dans la région souhaitée. Par exemple, dans le cas du séquençage de Sanger, la lecture finale fusionne les produits les plus abondants dans le modèle en un seul chromatogramme (Sanger & Coulson, Reference Sanger et Coulson 1975 Strauss et al., Reference Strauss, Kobori, Siu et Hood 1986). Cela peut conduire à des pics secondaires et parfois à un signal mixte en raison d'autres molécules amplifiées dans le mélange, et peut rendre très difficile la détection d'événements souhaités mais rares qui auraient pu se produire pendant le montage. La confirmation de l'édition réussie par le clonage ultérieur d'un produit de PCR mixte suivi de la récupération des colonies bactériennes qui portent la variante rare prend du temps et coûte cher. L'utilisation de T7E1 peut également donner des résultats non concluants en raison de sa dépendance à l'égard de l'endonucléase T7 1 pour digérer uniquement les fragments portant des mésappariements (Mashal et al., Référence Mashal, Koontz et Sklar 1995), qui manqueraient les mutants homozygotes, car il n'y a pas de fragments mésappariés disponible pour la digestion. De plus, les deux techniques peuvent être coûteuses pour le criblage d'un grand nombre d'échantillons (>100).

Ces limitations nous ont amenés à développer un moyen robuste et rentable de cribler efficacement un grand nombre d'échantillons. Nous présentons ici une approche de criblage à haut débit pour identifier les mutations à l'aide du séquençage Illumina, appelée CRISPR-finder. Nous décrivons à la fois la préparation de la bibliothèque des échantillons et le pipeline d'analyse pour identifier les événements d'édition. La méthode est compatible avec le séquençage sur différents instruments Illumina (MiSeq et HiSeq300), et les séquences de l'adaptateur pourraient être modifiées pour être utilisées sur d'autres plates-formes.

Notre approche s'inspire d'une méthode de séquençage d'amplicons précédemment développée pour regrouper des échantillons pour l'analyse de microbiomes (Lundberg et al., Référence Lundberg, Yourstone, Mieczkowski, Jones et Dangl 2013). Dans notre approche, les bibliothèques d'amplicons sont générées par une amplification PCR en deux étapes en utilisant des combinaisons spécifiques d'oligonucléotides pour la première étape. Au cours des PCR, des nucléotides de décalage de cadre et l'un des 96 indices uniques sont ajoutés. Sur la base de la combinaison unique des nucléotides de décalage du cadre et du code-barres, nous avons pu séquencer des centaines d'échantillons, par exemple >900 échantillons, en une seule analyse Illumina MiSeq. Pour illustrer l'exactitude et la précision de la méthode, nous décrivons comment nous avons identifié et caractérisé une lignée sans Cas9 avec une mutation dans le ISOCHORISMAT SYNTHASE 1 (ICS1) gène.


Visualisation

La commande test ou count est réussie mais j'ai quelques problèmes pour produire le fichier PDF. Comment puis-je générer le fichier PDF ?

UNE: MAgeCK va générer .R et .Rnw même si l'option "--pdf-report" n'est pas spécifiée. Vous pouvez copier ces fichiers sur un nouvel ordinateur où R et pdflatex sont correctement installés et utiliser la commande suivante pour générer des fichiers PDF :

Notez le pour compter commande, le fichier de nombre de lectures normalisé à la médiane (.median_normalized.csv) doit également être copié dans le même répertoire. Pour test commande, le fichier de résumé du gène (.gene_summary.txt) doit également être copié dans le même répertoire.

Je rencontre des problèmes de génération de fichiers pdf à l'aide de latex.

UNE: Vous pouvez obtenir des messages d'erreur comme celui-ci :

Cela peut être dû au problème de compatibilité système du latex. Vous pouvez toujours obtenir des chiffres générés à partir de MAgeCK, en ajoutant l'option "--keep-tmp" pour conserver les fichiers intermédiaires.